Incidental Mutation 'R6066:Zfp493'
ID484055
Institutional Source Beutler Lab
Gene Symbol Zfp493
Ensembl Gene ENSMUSG00000090659
Gene Namezinc finger protein 493
Synonyms2900054J07Rik
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6066 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67779693-67792512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67786950 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 341 (A341T)
Ref Sequence ENSEMBL: ENSMUSP00000132282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164936] [ENSMUST00000181319] [ENSMUST00000220570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164936
AA Change: A341T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132282
Gene: ENSMUSG00000090659
AA Change: A341T

DomainStartEndE-ValueType
KRAB 5 65 3.47e-32 SMART
ZnF_C2H2 81 103 2.27e-4 SMART
ZnF_C2H2 109 131 3.95e-4 SMART
ZnF_C2H2 137 159 7.37e-4 SMART
ZnF_C2H2 165 187 6.32e-3 SMART
ZnF_C2H2 193 215 2.99e-4 SMART
ZnF_C2H2 221 243 9.73e-4 SMART
ZnF_C2H2 249 271 2.57e-3 SMART
ZnF_C2H2 277 299 1.53e-1 SMART
ZnF_C2H2 305 327 1.1e-2 SMART
ZnF_C2H2 333 355 5.42e-2 SMART
ZnF_C2H2 361 383 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180507
Predicted Effect probably benign
Transcript: ENSMUST00000181319
SMART Domains Protein: ENSMUSP00000137936
Gene: ENSMUSG00000090659

DomainStartEndE-ValueType
KRAB 5 65 3.47e-32 SMART
low complexity region 80 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223540
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Zfp493
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Zfp493 APN 13 67786802 missense probably benign 0.06
IGL02367:Zfp493 APN 13 67786970 nonsense probably null
R0647:Zfp493 UTSW 13 67783875 missense possibly damaging 0.92
R1478:Zfp493 UTSW 13 67786561 missense probably damaging 1.00
R1617:Zfp493 UTSW 13 67783880 missense probably damaging 1.00
R1990:Zfp493 UTSW 13 67786269 missense probably damaging 1.00
R4007:Zfp493 UTSW 13 67783919 splice site probably benign
R4700:Zfp493 UTSW 13 67786617 missense probably damaging 1.00
R4782:Zfp493 UTSW 13 67786203 missense probably null 0.97
R5376:Zfp493 UTSW 13 67786318 missense possibly damaging 0.81
R5395:Zfp493 UTSW 13 67783846 nonsense probably null
R5909:Zfp493 UTSW 13 67786598 nonsense probably null
R6419:Zfp493 UTSW 13 67786407 missense probably benign 0.16
R6561:Zfp493 UTSW 13 67786219 missense possibly damaging 0.92
R6625:Zfp493 UTSW 13 67786395 nonsense probably null
R6714:Zfp493 UTSW 13 67786380 missense probably benign 0.06
R7678:Zfp493 UTSW 13 67779695 start gained probably benign
R7782:Zfp493 UTSW 13 67787004 missense probably benign 0.31
X0021:Zfp493 UTSW 13 67786378 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAATGTGGTAAGGCCTTTAGT -3'
(R):5'- TGCCACATTCCTTGCATTTGTAG -3'

Sequencing Primer
(F):5'- GTAAGGCCTTTAGTGCTCGCAC -3'
(R):5'- CCAATATGGATTCGCAGATGC -3'
Posted On2017-07-14