Incidental Mutation 'R6066:Pik3r1'
ID484056
Institutional Source Beutler Lab
Gene Symbol Pik3r1
Ensembl Gene ENSMUSG00000041417
Gene Namephosphoinositide-3-kinase regulatory subunit 1
Synonymsp55alpha, p85alpha, PI3K, p50alpha
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6066 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location101680563-101768217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101686320 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 625 (N625D)
Ref Sequence ENSEMBL: ENSMUSP00000056774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035532] [ENSMUST00000055518] [ENSMUST00000185795] [ENSMUST00000187009]
Predicted Effect probably benign
Transcript: ENSMUST00000035532
AA Change: N355D

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047004
Gene: ENSMUSG00000041417
AA Change: N355D

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
SH2 61 144 9.96e-28 SMART
low complexity region 263 278 N/A INTRINSIC
SH2 352 434 7.33e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000055518
AA Change: N625D

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056774
Gene: ENSMUSG00000041417
AA Change: N625D

DomainStartEndE-ValueType
SH3 6 78 2.81e-11 SMART
low complexity region 79 99 N/A INTRINSIC
RhoGAP 126 298 1.94e-37 SMART
low complexity region 303 314 N/A INTRINSIC
SH2 331 414 9.96e-28 SMART
Pfam:PI3K_P85_iSH2 431 599 7.8e-67 PFAM
SH2 622 704 7.33e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185795
SMART Domains Protein: ENSMUSP00000140312
Gene: ENSMUSG00000041417

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
SH2 31 112 1.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187009
SMART Domains Protein: ENSMUSP00000140256
Gene: ENSMUSG00000041417

DomainStartEndE-ValueType
SH2 10 93 6.5e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190171
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit perinatal lethality associated with hepatic necrosis, chylous ascites, enlarged muscle fibers, calcification of cardiac tissue, and hypoglycemia. Mutants lacking only the major isoform are immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Pik3r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pik3r1 APN 13 101690536 start codon destroyed probably benign
IGL00484:Pik3r1 APN 13 101701747 missense probably benign 0.08
IGL00911:Pik3r1 APN 13 101757661 utr 5 prime probably benign
IGL01620:Pik3r1 APN 13 101686220 missense probably damaging 1.00
IGL01872:Pik3r1 APN 13 101689117 missense probably benign 0.01
IGL02544:Pik3r1 APN 13 101687276 missense probably damaging 1.00
IGL02959:Pik3r1 APN 13 101757529 missense probably benign 0.02
anubis UTSW 13 101702776 nonsense probably null
astro_boy UTSW 13 101701732 missense probably damaging 1.00
pennywhistle UTSW 13 101689406 missense probably damaging 0.96
Rocket UTSW 13 101689444 missense probably damaging 1.00
R0635:Pik3r1 UTSW 13 101757418 missense probably benign
R0751:Pik3r1 UTSW 13 101686358 unclassified probably null
R0787:Pik3r1 UTSW 13 101690523 missense probably benign 0.30
R0845:Pik3r1 UTSW 13 101686264 missense probably benign 0.45
R0891:Pik3r1 UTSW 13 101701466 missense probably benign
R1066:Pik3r1 UTSW 13 101688663 missense probably damaging 1.00
R1184:Pik3r1 UTSW 13 101686358 unclassified probably null
R1735:Pik3r1 UTSW 13 101686374 missense probably damaging 1.00
R2474:Pik3r1 UTSW 13 101702776 nonsense probably null
R3015:Pik3r1 UTSW 13 101687263 missense probably damaging 1.00
R3419:Pik3r1 UTSW 13 101692215 missense probably benign 0.17
R3876:Pik3r1 UTSW 13 101684957 missense probably benign 0.01
R3964:Pik3r1 UTSW 13 101688685 missense possibly damaging 0.75
R4175:Pik3r1 UTSW 13 101701732 missense probably damaging 1.00
R4175:Pik3r1 UTSW 13 101701733 missense probably benign 0.25
R4422:Pik3r1 UTSW 13 101694384 missense probably benign
R4890:Pik3r1 UTSW 13 101757610 missense probably damaging 1.00
R5038:Pik3r1 UTSW 13 101689444 missense probably damaging 1.00
R5117:Pik3r1 UTSW 13 101692236 missense probably benign
R6254:Pik3r1 UTSW 13 101689406 missense possibly damaging 0.89
R7421:Pik3r1 UTSW 13 101689136 missense probably damaging 1.00
R7507:Pik3r1 UTSW 13 101708982 missense probably benign 0.00
R7538:Pik3r1 UTSW 13 101689406 missense probably damaging 0.96
R7605:Pik3r1 UTSW 13 101702838 missense probably benign
R7739:Pik3r1 UTSW 13 101709697 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAGGTGTCTGTCTCTCTG -3'
(R):5'- AATAACTTTCTGCCAGCCATTCAC -3'

Sequencing Primer
(F):5'- AGATTCATCTGCCTGGACTAAC -3'
(R):5'- TGCCAGCCATTCACCCTGG -3'
Posted On2017-07-14