Mutagenetix > Incidental Mutations

Incidental Mutation 'R6066:Vmn2r104'

484063

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

044230-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R6066 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20038311 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 524 (F524L)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168050
AA Change: F524L

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: F524L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrb1	T	C	15: 74,540,459	F429S	probably damaging	Het
Ahi1	A	T	10: 20,959,926	M53L	possibly damaging	Het
Ahr	A	T	12: 35,504,921	F400I	probably damaging	Het
Ak7	G	T	12: 105,733,491	G223V	possibly damaging	Het
Alpk3	A	G	7: 81,076,950	I128V	possibly damaging	Het
Ampd3	A	T	7: 110,793,767	E247D	probably benign	Het
Arhgap44	CTGCT	CTGCTTGCT	11: 65,032,084		probably null	Het
Arhgef10l	A	G	4: 140,577,080	F243L	probably damaging	Het
Cdh23	A	T	10: 60,433,758	V661E	probably damaging	Het
Cox8c	A	G	12: 102,900,275	T53A	probably benign	Het
Creld2	C	A	15: 88,823,766	T236K	possibly damaging	Het
Cul3	A	T	1: 80,283,759	C250S	probably benign	Het
Dhx37	A	C	5: 125,424,666	F510V	probably benign	Het
Fblim1	T	C	4: 141,577,909	D350G	probably damaging	Het
Lipm	A	G	19: 34,112,974	Y185C	probably damaging	Het
Mfsd4b4	A	G	10: 39,892,053	F348S	probably benign	Het
Misp	A	G	10: 79,826,312	R188G	possibly damaging	Het
Nbeal1	T	G	1: 60,248,405	I936S	probably benign	Het
Ngly1	G	A	14: 16,294,634	M521I	probably benign	Het
Nlrp9a	A	T	7: 26,558,085	Y376F	probably benign	Het
Oas3	T	C	5: 120,772,924	K197R	probably damaging	Het
Pars2	T	C	4: 106,654,079	Y353H	probably damaging	Het
Pik3r1	T	C	13: 101,686,320	N625D	possibly damaging	Het
Pkhd1l1	T	A	15: 44,528,129	S1530R	probably damaging	Het
Rsph6a	C	T	7: 19,065,815	P457L	probably damaging	Het
Secisbp2	T	C	13: 51,677,222	S565P	probably benign	Het
Slc28a3	T	C	13: 58,578,487	M163V	probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Svil	T	G	18: 5,106,724	V1855G	probably damaging	Het
Szt2	T	C	4: 118,371,974	T2890A	unknown	Het
Tatdn3	A	T	1: 191,046,268	V242E	probably benign	Het
Vmn1r22	T	G	6: 57,900,879	M38L	probably benign	Het
Vmn2r94	A	G	17: 18,257,433	S239P	probably damaging	Het
Xpo7	T	C	14: 70,682,338	D679G	probably null	Het
Zbtb42	C	A	12: 112,679,607	T72K	probably damaging	Het
Zfp493	G	A	13: 67,786,950	A341T	possibly damaging	Het
Zfp811	A	G	17: 32,798,827	C80R	possibly damaging	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTTGAGCTATTTCAAGGGAATAG -3'
(R):5'- TGACATCTGTGACTTTCTGGTC -3'

Sequencing Primer
(F):5'- CTATTTCAAGGGAATAGTGATGAGC -3'
(R):5'- GACTTTCTGGTCACTACCCCTAG -3'

Posted On

2017-07-14