Incidental Mutation 'R6051:BB014433'
ID484092
Institutional Source Beutler Lab
Gene Symbol BB014433
Ensembl Gene ENSMUSG00000049008
Gene Nameexpressed sequence BB014433
Synonyms
MMRRC Submission 044219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6051 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location15041444-15046078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15042179 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 225 (T225A)
Ref Sequence ENSEMBL: ENSMUSP00000137001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050493] [ENSMUST00000123331] [ENSMUST00000179941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050493
AA Change: T225A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000123331
SMART Domains Protein: ENSMUSP00000116138
Gene: ENSMUSG00000049008

DomainStartEndE-ValueType
internal_repeat_1 27 51 1.93e-5 PROSPERO
internal_repeat_2 31 59 5.9e-5 PROSPERO
internal_repeat_2 85 113 5.9e-5 PROSPERO
internal_repeat_1 95 117 1.93e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000179941
AA Change: T225A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209938
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G T 1: 37,624,225 P864Q probably damaging Het
2310035C23Rik G T 1: 105,721,272 G712V probably damaging Het
2700049A03Rik G T 12: 71,184,530 A1021S possibly damaging Het
Abl2 A G 1: 156,642,085 D869G probably damaging Het
Adamts9 G A 6: 92,859,926 A615V possibly damaging Het
Adamts9 A G 6: 92,890,118 Y96H probably damaging Het
Arhgef37 A G 18: 61,507,274 I238T probably damaging Het
Atr T A 9: 95,908,369 H1587Q possibly damaging Het
Bcas2 T C 3: 103,174,341 Y87H possibly damaging Het
Brca1 C T 11: 101,524,246 E160K probably damaging Het
Cd2ap T C 17: 42,796,328 *638W probably null Het
Chd2 A T 7: 73,435,842 D1681E probably benign Het
Cit C T 5: 115,846,405 P12L probably benign Het
Crisp1 T C 17: 40,305,126 Y120C possibly damaging Het
Cyp2c65 A G 19: 39,061,166 D46G probably benign Het
Cyp2d34 A T 15: 82,616,770 V387D probably damaging Het
E130311K13Rik T C 3: 63,915,641 H194R probably benign Het
Egfr C A 11: 16,883,607 T625N possibly damaging Het
Fat3 A G 9: 16,375,455 V924A possibly damaging Het
Fgd6 T C 10: 94,137,565 probably null Het
Galnt6 A T 15: 100,694,668 C553S probably damaging Het
Gm5617 T C 9: 48,495,887 L107P possibly damaging Het
Hectd1 G T 12: 51,754,104 T2035N probably benign Het
Hp1bp3 A G 4: 138,234,304 T154A possibly damaging Het
Il10rb A G 16: 91,421,864 T262A probably benign Het
Kansl1l A T 1: 66,726,726 N704K probably null Het
Kbtbd12 T C 6: 88,617,948 D300G possibly damaging Het
Lama4 G A 10: 39,067,902 A734T probably benign Het
Mllt6 G T 11: 97,680,743 G1069* probably null Het
Mns1 T C 9: 72,449,453 L302P probably damaging Het
Muc5ac T A 7: 141,811,857 C2039S possibly damaging Het
Myof A G 19: 38,024,361 L42P probably damaging Het
Ncoa3 T C 2: 166,058,765 L868S probably damaging Het
Ndc80 C T 17: 71,517,578 G212E probably benign Het
Ntn4 A G 10: 93,745,795 H610R probably benign Het
Nufip2 T A 11: 77,691,916 Y219N probably damaging Het
Olfr631 T C 7: 103,928,877 F18S probably damaging Het
Pbxip1 T C 3: 89,443,170 S41P probably benign Het
Phactr2 A T 10: 13,261,811 C196S probably null Het
Ppp3ca T A 3: 136,876,122 Y140N probably damaging Het
Ptprb C A 10: 116,341,090 Y1260* probably null Het
Rap1a C T 3: 105,750,297 R2H possibly damaging Het
Rbbp8 G A 18: 11,738,607 V794I probably benign Het
Rbks T C 5: 31,651,819 N200S probably damaging Het
Rnf186 G T 4: 138,967,966 K272N probably damaging Het
Rtl1 G A 12: 109,593,024 P794S probably damaging Het
Tbc1d30 T A 10: 121,296,845 I205F probably damaging Het
Tkt C T 14: 30,568,196 P261S probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttc14 T C 3: 33,808,924 probably benign Het
Ttn A G 2: 76,907,461 S4245P probably benign Het
Vmn1r75 A T 7: 11,881,051 I237F probably damaging Het
Vmn2r57 T A 7: 41,448,472 H57L probably benign Het
Wdr62 T C 7: 30,261,384 N40S possibly damaging Het
Xcr1 A T 9: 123,856,116 F194I probably benign Het
Zmiz1 T A 14: 25,572,070 M1K probably null Het
Other mutations in BB014433
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:BB014433 APN 8 15042510 missense probably benign 0.03
IGL01595:BB014433 APN 8 15042499 unclassified probably null
IGL02056:BB014433 APN 8 15042435 nonsense probably null
IGL02470:BB014433 APN 8 15042803 missense unknown
R0359:BB014433 UTSW 8 15042540 nonsense probably null
R1066:BB014433 UTSW 8 15042185 missense probably damaging 1.00
R1837:BB014433 UTSW 8 15042629 missense unknown
R1838:BB014433 UTSW 8 15042629 missense unknown
R2227:BB014433 UTSW 8 15041717 missense probably benign 0.34
R4508:BB014433 UTSW 8 15042095 missense possibly damaging 0.83
R4882:BB014433 UTSW 8 15042016 missense probably benign 0.05
R4996:BB014433 UTSW 8 15042166 missense probably benign 0.10
R5988:BB014433 UTSW 8 15041854 missense probably damaging 1.00
R6483:BB014433 UTSW 8 15042208 missense probably benign 0.10
R6505:BB014433 UTSW 8 15042304 missense probably benign 0.10
R7237:BB014433 UTSW 8 15041765 missense probably benign 0.13
R7771:BB014433 UTSW 8 15042395 missense probably damaging 1.00
R7847:BB014433 UTSW 8 15042160 small deletion probably benign
R7859:BB014433 UTSW 8 15042160 small deletion probably benign
X0066:BB014433 UTSW 8 15042833 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGCACACAGCTTTGGAGG -3'
(R):5'- GGTGTCTGCAACCCCAAAAC -3'

Sequencing Primer
(F):5'- CAGCTTTGGAGGTGTACACAC -3'
(R):5'- CCTAACTGAGGTGTCTGCAC -3'
Posted On2017-07-14