Incidental Mutation 'R6051:Fgd6'
ID 484101
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene Name FYVE, RhoGEF and PH domain containing 6
Synonyms Etohd4, ZFYVE24
MMRRC Submission 044219-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.387) question?
Stock # R6051 (G1)
Quality Score 178.009
Status Not validated
Chromosome 10
Chromosomal Location 93871863-93981201 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 93973427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
AlphaFold Q69ZL1
PDB Structure Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000020208
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125535
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,231,304 (GRCm39) A1021S possibly damaging Het
Abl2 A G 1: 156,469,655 (GRCm39) D869G probably damaging Het
Adamts9 G A 6: 92,836,907 (GRCm39) A615V possibly damaging Het
Adamts9 A G 6: 92,867,099 (GRCm39) Y96H probably damaging Het
Arhgef37 A G 18: 61,640,345 (GRCm39) I238T probably damaging Het
Atr T A 9: 95,790,422 (GRCm39) H1587Q possibly damaging Het
BB014433 T C 8: 15,092,179 (GRCm39) T225A possibly damaging Het
Bcas2 T C 3: 103,081,657 (GRCm39) Y87H possibly damaging Het
Brca1 C T 11: 101,415,072 (GRCm39) E160K probably damaging Het
Cd2ap T C 17: 43,107,219 (GRCm39) *638W probably null Het
Chd2 A T 7: 73,085,590 (GRCm39) D1681E probably benign Het
Cit C T 5: 115,984,464 (GRCm39) P12L probably benign Het
Cracdl G T 1: 37,663,306 (GRCm39) P864Q probably damaging Het
Crisp1 T C 17: 40,616,017 (GRCm39) Y120C possibly damaging Het
Cyp2c65 A G 19: 39,049,610 (GRCm39) D46G probably benign Het
Cyp2d34 A T 15: 82,500,971 (GRCm39) V387D probably damaging Het
E130311K13Rik T C 3: 63,823,062 (GRCm39) H194R probably benign Het
Egfr C A 11: 16,833,607 (GRCm39) T625N possibly damaging Het
Fat3 A G 9: 16,286,751 (GRCm39) V924A possibly damaging Het
Galnt6 A T 15: 100,592,549 (GRCm39) C553S probably damaging Het
Gm5617 T C 9: 48,407,187 (GRCm39) L107P possibly damaging Het
Hectd1 G T 12: 51,800,887 (GRCm39) T2035N probably benign Het
Hp1bp3 A G 4: 137,961,615 (GRCm39) T154A possibly damaging Het
Il10rb A G 16: 91,218,752 (GRCm39) T262A probably benign Het
Kansl1l A T 1: 66,765,885 (GRCm39) N704K probably null Het
Kbtbd12 T C 6: 88,594,930 (GRCm39) D300G possibly damaging Het
Lama4 G A 10: 38,943,898 (GRCm39) A734T probably benign Het
Mllt6 G T 11: 97,571,569 (GRCm39) G1069* probably null Het
Mns1 T C 9: 72,356,735 (GRCm39) L302P probably damaging Het
Muc5ac T A 7: 141,365,594 (GRCm39) C2039S possibly damaging Het
Myof A G 19: 38,012,809 (GRCm39) L42P probably damaging Het
Ncoa3 T C 2: 165,900,685 (GRCm39) L868S probably damaging Het
Ndc80 C T 17: 71,824,573 (GRCm39) G212E probably benign Het
Ntn4 A G 10: 93,581,657 (GRCm39) H610R probably benign Het
Nufip2 T A 11: 77,582,742 (GRCm39) Y219N probably damaging Het
Or51m1 T C 7: 103,578,084 (GRCm39) F18S probably damaging Het
Pbxip1 T C 3: 89,350,477 (GRCm39) S41P probably benign Het
Phactr2 A T 10: 13,137,555 (GRCm39) C196S probably null Het
Ppp3ca T A 3: 136,581,883 (GRCm39) Y140N probably damaging Het
Ptprb C A 10: 116,176,995 (GRCm39) Y1260* probably null Het
Rap1a C T 3: 105,657,613 (GRCm39) R2H possibly damaging Het
Rbbp8 G A 18: 11,871,664 (GRCm39) V794I probably benign Het
Rbks T C 5: 31,809,163 (GRCm39) N200S probably damaging Het
Relch G T 1: 105,648,997 (GRCm39) G712V probably damaging Het
Rnf186 G T 4: 138,695,277 (GRCm39) K272N probably damaging Het
Rtl1 G A 12: 109,559,458 (GRCm39) P794S probably damaging Het
Tbc1d30 T A 10: 121,132,750 (GRCm39) I205F probably damaging Het
Tkt C T 14: 30,290,153 (GRCm39) P261S probably benign Het
Trp53 G A 11: 69,480,434 (GRCm39) R267H possibly damaging Het
Ttc14 T C 3: 33,863,073 (GRCm39) probably benign Het
Ttn A G 2: 76,737,805 (GRCm39) S4245P probably benign Het
Vmn1r75 A T 7: 11,614,978 (GRCm39) I237F probably damaging Het
Vmn2r57 T A 7: 41,097,896 (GRCm39) H57L probably benign Het
Wdr62 T C 7: 29,960,809 (GRCm39) N40S possibly damaging Het
Xcr1 A T 9: 123,685,181 (GRCm39) F194I probably benign Het
Zmiz1 T A 14: 25,572,494 (GRCm39) M1K probably null Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 93,879,496 (GRCm39) missense probably benign 0.01
IGL00975:Fgd6 APN 10 93,969,938 (GRCm39) missense probably damaging 0.98
IGL01366:Fgd6 APN 10 93,879,338 (GRCm39) missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 93,925,512 (GRCm39) splice site probably null
IGL01958:Fgd6 APN 10 93,974,170 (GRCm39) missense probably benign 0.25
IGL01988:Fgd6 APN 10 93,910,197 (GRCm39) splice site probably benign
IGL02019:Fgd6 APN 10 93,969,216 (GRCm39) missense probably damaging 1.00
IGL02074:Fgd6 APN 10 93,963,297 (GRCm39) missense probably damaging 1.00
IGL02227:Fgd6 APN 10 93,969,946 (GRCm39) missense probably damaging 1.00
IGL02262:Fgd6 APN 10 93,961,490 (GRCm39) missense probably damaging 0.98
IGL02353:Fgd6 APN 10 93,974,258 (GRCm39) missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 93,974,258 (GRCm39) missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 93,910,064 (GRCm39) missense probably benign 0.00
IGL02526:Fgd6 APN 10 93,936,373 (GRCm39) missense probably benign 0.21
IGL02607:Fgd6 APN 10 93,880,310 (GRCm39) missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 93,959,152 (GRCm39) missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 93,881,026 (GRCm39) missense probably damaging 1.00
IGL02884:Fgd6 APN 10 93,881,501 (GRCm39) splice site probably benign
IGL02995:Fgd6 APN 10 93,881,342 (GRCm39) nonsense probably null
IGL03189:Fgd6 APN 10 93,880,318 (GRCm39) missense probably benign 0.26
IGL03258:Fgd6 APN 10 93,969,215 (GRCm39) missense probably benign 0.44
IGL03396:Fgd6 APN 10 93,880,318 (GRCm39) missense probably benign 0.26
FR4449:Fgd6 UTSW 10 93,880,182 (GRCm39) small deletion probably benign
R0257:Fgd6 UTSW 10 93,879,777 (GRCm39) missense probably benign 0.11
R0926:Fgd6 UTSW 10 93,970,909 (GRCm39) missense probably benign 0.40
R1325:Fgd6 UTSW 10 93,963,289 (GRCm39) missense probably damaging 1.00
R1422:Fgd6 UTSW 10 93,881,234 (GRCm39) missense probably damaging 1.00
R1491:Fgd6 UTSW 10 93,880,694 (GRCm39) missense probably benign 0.06
R1593:Fgd6 UTSW 10 93,880,894 (GRCm39) missense probably damaging 1.00
R1624:Fgd6 UTSW 10 93,973,298 (GRCm39) missense probably benign 0.19
R1929:Fgd6 UTSW 10 93,880,868 (GRCm39) missense probably benign 0.01
R2064:Fgd6 UTSW 10 93,880,903 (GRCm39) missense probably damaging 0.98
R2965:Fgd6 UTSW 10 93,880,056 (GRCm39) missense probably benign 0.03
R2966:Fgd6 UTSW 10 93,880,056 (GRCm39) missense probably benign 0.03
R3889:Fgd6 UTSW 10 93,925,499 (GRCm39) missense probably damaging 1.00
R4094:Fgd6 UTSW 10 93,879,296 (GRCm39) missense probably damaging 1.00
R4605:Fgd6 UTSW 10 93,880,217 (GRCm39) missense probably benign 0.12
R4883:Fgd6 UTSW 10 93,975,715 (GRCm39) missense probably benign 0.00
R5217:Fgd6 UTSW 10 93,969,939 (GRCm39) missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 93,880,538 (GRCm39) missense probably benign 0.00
R5606:Fgd6 UTSW 10 93,974,190 (GRCm39) nonsense probably null
R5644:Fgd6 UTSW 10 93,969,912 (GRCm39) missense possibly damaging 0.80
R6258:Fgd6 UTSW 10 93,880,161 (GRCm39) missense probably benign 0.00
R6735:Fgd6 UTSW 10 93,910,182 (GRCm39) missense possibly damaging 0.94
R7181:Fgd6 UTSW 10 93,879,373 (GRCm39) missense probably benign 0.02
R7210:Fgd6 UTSW 10 93,969,954 (GRCm39) missense probably damaging 0.98
R7296:Fgd6 UTSW 10 93,975,743 (GRCm39) missense probably benign 0.02
R7296:Fgd6 UTSW 10 93,879,909 (GRCm39) nonsense probably null
R7697:Fgd6 UTSW 10 93,881,306 (GRCm39) missense probably damaging 0.99
R7747:Fgd6 UTSW 10 93,880,778 (GRCm39) missense probably damaging 1.00
R7861:Fgd6 UTSW 10 93,939,193 (GRCm39) missense probably benign 0.15
R7940:Fgd6 UTSW 10 93,956,344 (GRCm39) missense probably benign 0.02
R8022:Fgd6 UTSW 10 93,880,206 (GRCm39) missense possibly damaging 0.54
R8138:Fgd6 UTSW 10 93,970,005 (GRCm39) missense probably null 0.45
R8171:Fgd6 UTSW 10 93,910,194 (GRCm39) critical splice donor site probably null
R8189:Fgd6 UTSW 10 93,910,077 (GRCm39) missense probably benign 0.00
R8213:Fgd6 UTSW 10 93,879,914 (GRCm39) missense probably benign 0.37
R8960:Fgd6 UTSW 10 93,880,868 (GRCm39) missense probably benign 0.06
R8981:Fgd6 UTSW 10 93,880,916 (GRCm39) missense possibly damaging 0.80
R8989:Fgd6 UTSW 10 93,959,425 (GRCm39) missense probably damaging 0.97
R9609:Fgd6 UTSW 10 93,879,674 (GRCm39) missense probably damaging 0.99
RF031:Fgd6 UTSW 10 93,880,187 (GRCm39) frame shift probably null
RF040:Fgd6 UTSW 10 93,880,187 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGGGAGTCTGAGTGCTC -3'
(R):5'- TGGAGGTCAGCATACACTCC -3'

Sequencing Primer
(F):5'- CACTCTTGCTTGCCACATGAG -3'
(R):5'- GGTCAGCATACACTCCGATCCG -3'
Posted On 2017-07-14