Incidental Mutation 'R6051:Fgd6'
ID484101
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene NameFYVE, RhoGEF and PH domain containing 6
SynonymsEtohd4, ZFYVE24
MMRRC Submission 044219-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R6051 (G1)
Quality Score178.009
Status Not validated
Chromosome10
Chromosomal Location94036001-94145339 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94137565 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
PDB Structure
Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000020208
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125535
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G T 1: 37,624,225 P864Q probably damaging Het
2310035C23Rik G T 1: 105,721,272 G712V probably damaging Het
2700049A03Rik G T 12: 71,184,530 A1021S possibly damaging Het
Abl2 A G 1: 156,642,085 D869G probably damaging Het
Adamts9 G A 6: 92,859,926 A615V possibly damaging Het
Adamts9 A G 6: 92,890,118 Y96H probably damaging Het
Arhgef37 A G 18: 61,507,274 I238T probably damaging Het
Atr T A 9: 95,908,369 H1587Q possibly damaging Het
BB014433 T C 8: 15,042,179 T225A possibly damaging Het
Bcas2 T C 3: 103,174,341 Y87H possibly damaging Het
Brca1 C T 11: 101,524,246 E160K probably damaging Het
Cd2ap T C 17: 42,796,328 *638W probably null Het
Chd2 A T 7: 73,435,842 D1681E probably benign Het
Cit C T 5: 115,846,405 P12L probably benign Het
Crisp1 T C 17: 40,305,126 Y120C possibly damaging Het
Cyp2c65 A G 19: 39,061,166 D46G probably benign Het
Cyp2d34 A T 15: 82,616,770 V387D probably damaging Het
E130311K13Rik T C 3: 63,915,641 H194R probably benign Het
Egfr C A 11: 16,883,607 T625N possibly damaging Het
Fat3 A G 9: 16,375,455 V924A possibly damaging Het
Galnt6 A T 15: 100,694,668 C553S probably damaging Het
Gm5617 T C 9: 48,495,887 L107P possibly damaging Het
Hectd1 G T 12: 51,754,104 T2035N probably benign Het
Hp1bp3 A G 4: 138,234,304 T154A possibly damaging Het
Il10rb A G 16: 91,421,864 T262A probably benign Het
Kansl1l A T 1: 66,726,726 N704K probably null Het
Kbtbd12 T C 6: 88,617,948 D300G possibly damaging Het
Lama4 G A 10: 39,067,902 A734T probably benign Het
Mllt6 G T 11: 97,680,743 G1069* probably null Het
Mns1 T C 9: 72,449,453 L302P probably damaging Het
Muc5ac T A 7: 141,811,857 C2039S possibly damaging Het
Myof A G 19: 38,024,361 L42P probably damaging Het
Ncoa3 T C 2: 166,058,765 L868S probably damaging Het
Ndc80 C T 17: 71,517,578 G212E probably benign Het
Ntn4 A G 10: 93,745,795 H610R probably benign Het
Nufip2 T A 11: 77,691,916 Y219N probably damaging Het
Olfr631 T C 7: 103,928,877 F18S probably damaging Het
Pbxip1 T C 3: 89,443,170 S41P probably benign Het
Phactr2 A T 10: 13,261,811 C196S probably null Het
Ppp3ca T A 3: 136,876,122 Y140N probably damaging Het
Ptprb C A 10: 116,341,090 Y1260* probably null Het
Rap1a C T 3: 105,750,297 R2H possibly damaging Het
Rbbp8 G A 18: 11,738,607 V794I probably benign Het
Rbks T C 5: 31,651,819 N200S probably damaging Het
Rnf186 G T 4: 138,967,966 K272N probably damaging Het
Rtl1 G A 12: 109,593,024 P794S probably damaging Het
Tbc1d30 T A 10: 121,296,845 I205F probably damaging Het
Tkt C T 14: 30,568,196 P261S probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttc14 T C 3: 33,808,924 probably benign Het
Ttn A G 2: 76,907,461 S4245P probably benign Het
Vmn1r75 A T 7: 11,881,051 I237F probably damaging Het
Vmn2r57 T A 7: 41,448,472 H57L probably benign Het
Wdr62 T C 7: 30,261,384 N40S possibly damaging Het
Xcr1 A T 9: 123,856,116 F194I probably benign Het
Zmiz1 T A 14: 25,572,070 M1K probably null Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 94043634 missense probably benign 0.01
IGL00975:Fgd6 APN 10 94134076 missense probably damaging 0.98
IGL01366:Fgd6 APN 10 94043476 missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 94089650 splice site probably null
IGL01958:Fgd6 APN 10 94138308 missense probably benign 0.25
IGL01988:Fgd6 APN 10 94074335 splice site probably benign
IGL02019:Fgd6 APN 10 94133354 missense probably damaging 1.00
IGL02074:Fgd6 APN 10 94127435 missense probably damaging 1.00
IGL02227:Fgd6 APN 10 94134084 missense probably damaging 1.00
IGL02262:Fgd6 APN 10 94125628 missense probably damaging 0.98
IGL02353:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 94074202 missense probably benign 0.00
IGL02526:Fgd6 APN 10 94100511 missense probably benign 0.21
IGL02607:Fgd6 APN 10 94044448 missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 94123290 missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 94045164 missense probably damaging 1.00
IGL02884:Fgd6 APN 10 94045639 splice site probably benign
IGL02995:Fgd6 APN 10 94045480 nonsense probably null
IGL03189:Fgd6 APN 10 94044456 missense probably benign 0.26
IGL03258:Fgd6 APN 10 94133353 missense probably benign 0.44
IGL03396:Fgd6 APN 10 94044456 missense probably benign 0.26
FR4449:Fgd6 UTSW 10 94044320 small deletion probably benign
R0257:Fgd6 UTSW 10 94043915 missense probably benign 0.11
R0926:Fgd6 UTSW 10 94135047 missense probably benign 0.40
R1325:Fgd6 UTSW 10 94127427 missense probably damaging 1.00
R1422:Fgd6 UTSW 10 94045372 missense probably damaging 1.00
R1491:Fgd6 UTSW 10 94044832 missense probably benign 0.06
R1593:Fgd6 UTSW 10 94045032 missense probably damaging 1.00
R1624:Fgd6 UTSW 10 94137436 missense probably benign 0.19
R1929:Fgd6 UTSW 10 94045006 missense probably benign 0.01
R2064:Fgd6 UTSW 10 94045041 missense probably damaging 0.98
R2965:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R2966:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R3889:Fgd6 UTSW 10 94089637 missense probably damaging 1.00
R4094:Fgd6 UTSW 10 94043434 missense probably damaging 1.00
R4605:Fgd6 UTSW 10 94044355 missense probably benign 0.12
R4883:Fgd6 UTSW 10 94139853 missense probably benign 0.00
R5217:Fgd6 UTSW 10 94134077 missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 94044676 missense probably benign 0.00
R5606:Fgd6 UTSW 10 94138328 nonsense probably null
R5644:Fgd6 UTSW 10 94134050 missense possibly damaging 0.80
R6258:Fgd6 UTSW 10 94044299 missense probably benign 0.00
R6735:Fgd6 UTSW 10 94074320 missense possibly damaging 0.94
R7181:Fgd6 UTSW 10 94043511 missense probably benign 0.02
R7210:Fgd6 UTSW 10 94134092 missense probably damaging 0.98
R7296:Fgd6 UTSW 10 94044047 nonsense probably null
R7296:Fgd6 UTSW 10 94139881 missense probably benign 0.02
R7697:Fgd6 UTSW 10 94045444 missense probably damaging 0.99
R7747:Fgd6 UTSW 10 94044916 missense probably damaging 1.00
R7861:Fgd6 UTSW 10 94103331 missense probably benign 0.15
R8022:Fgd6 UTSW 10 94044344 missense possibly damaging 0.54
R8138:Fgd6 UTSW 10 94134143 missense probably null 0.45
R8171:Fgd6 UTSW 10 94074332 critical splice donor site probably null
R8189:Fgd6 UTSW 10 94074215 missense probably benign 0.00
R8213:Fgd6 UTSW 10 94044052 missense probably benign 0.37
RF031:Fgd6 UTSW 10 94044325 frame shift probably null
RF040:Fgd6 UTSW 10 94044325 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGGGAGTCTGAGTGCTC -3'
(R):5'- TGGAGGTCAGCATACACTCC -3'

Sequencing Primer
(F):5'- CACTCTTGCTTGCCACATGAG -3'
(R):5'- GGTCAGCATACACTCCGATCCG -3'
Posted On2017-07-14