Mutagenetix > Incidental Mutations

Incidental Mutation 'R6051:Egfr'

484104

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

044219-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R6051 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 16883607 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 625 (T625N)

Ref Sequence

ENSEMBL: ENSMUSP00000099948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884] [ENSMUST00000125984]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020329
AA Change: T625N

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: T625N

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102884
AA Change: T625N

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: T625N

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	5e-33	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	2e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.54e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125984
AA Change: T118N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122632
Gene: ENSMUSG00000020122
AA Change: T118N

Domain	Start	End	E-Value	Type
FU	1	40	2.55e0	SMART
FU	45	94	4.38e-10	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	G	T	1: 37,624,225	P864Q	probably damaging	Het
2310035C23Rik	G	T	1: 105,721,272	G712V	probably damaging	Het
2700049A03Rik	G	T	12: 71,184,530	A1021S	possibly damaging	Het
Abl2	A	G	1: 156,642,085	D869G	probably damaging	Het
Adamts9	G	A	6: 92,859,926	A615V	possibly damaging	Het
Adamts9	A	G	6: 92,890,118	Y96H	probably damaging	Het
Arhgef37	A	G	18: 61,507,274	I238T	probably damaging	Het
Atr	T	A	9: 95,908,369	H1587Q	possibly damaging	Het
BB014433	T	C	8: 15,042,179	T225A	possibly damaging	Het
Bcas2	T	C	3: 103,174,341	Y87H	possibly damaging	Het
Brca1	C	T	11: 101,524,246	E160K	probably damaging	Het
Cd2ap	T	C	17: 42,796,328	*638W	probably null	Het
Chd2	A	T	7: 73,435,842	D1681E	probably benign	Het
Cit	C	T	5: 115,846,405	P12L	probably benign	Het
Crisp1	T	C	17: 40,305,126	Y120C	possibly damaging	Het
Cyp2c65	A	G	19: 39,061,166	D46G	probably benign	Het
Cyp2d34	A	T	15: 82,616,770	V387D	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,641	H194R	probably benign	Het
Fat3	A	G	9: 16,375,455	V924A	possibly damaging	Het
Fgd6	T	C	10: 94,137,565		probably null	Het
Galnt6	A	T	15: 100,694,668	C553S	probably damaging	Het
Gm5617	T	C	9: 48,495,887	L107P	possibly damaging	Het
Hectd1	G	T	12: 51,754,104	T2035N	probably benign	Het
Hp1bp3	A	G	4: 138,234,304	T154A	possibly damaging	Het
Il10rb	A	G	16: 91,421,864	T262A	probably benign	Het
Kansl1l	A	T	1: 66,726,726	N704K	probably null	Het
Kbtbd12	T	C	6: 88,617,948	D300G	possibly damaging	Het
Lama4	G	A	10: 39,067,902	A734T	probably benign	Het
Mllt6	G	T	11: 97,680,743	G1069*	probably null	Het
Mns1	T	C	9: 72,449,453	L302P	probably damaging	Het
Muc5ac	T	A	7: 141,811,857	C2039S	possibly damaging	Het
Myof	A	G	19: 38,024,361	L42P	probably damaging	Het
Ncoa3	T	C	2: 166,058,765	L868S	probably damaging	Het
Ndc80	C	T	17: 71,517,578	G212E	probably benign	Het
Ntn4	A	G	10: 93,745,795	H610R	probably benign	Het
Nufip2	T	A	11: 77,691,916	Y219N	probably damaging	Het
Olfr631	T	C	7: 103,928,877	F18S	probably damaging	Het
Pbxip1	T	C	3: 89,443,170	S41P	probably benign	Het
Phactr2	A	T	10: 13,261,811	C196S	probably null	Het
Ppp3ca	T	A	3: 136,876,122	Y140N	probably damaging	Het
Ptprb	C	A	10: 116,341,090	Y1260*	probably null	Het
Rap1a	C	T	3: 105,750,297	R2H	possibly damaging	Het
Rbbp8	G	A	18: 11,738,607	V794I	probably benign	Het
Rbks	T	C	5: 31,651,819	N200S	probably damaging	Het
Rnf186	G	T	4: 138,967,966	K272N	probably damaging	Het
Rtl1	G	A	12: 109,593,024	P794S	probably damaging	Het
Tbc1d30	T	A	10: 121,296,845	I205F	probably damaging	Het
Tkt	C	T	14: 30,568,196	P261S	probably benign	Het
Trp53	G	A	11: 69,589,608	R267H	possibly damaging	Het
Ttc14	T	C	3: 33,808,924		probably benign	Het
Ttn	A	G	2: 76,907,461	S4245P	probably benign	Het
Vmn1r75	A	T	7: 11,881,051	I237F	probably damaging	Het
Vmn2r57	T	A	7: 41,448,472	H57L	probably benign	Het
Wdr62	T	C	7: 30,261,384	N40S	possibly damaging	Het
Xcr1	A	T	9: 123,856,116	F194I	probably benign	Het
Zmiz1	T	A	14: 25,572,070	M1K	probably null	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATGTGCAACCTTTTCTATGCC -3'
(R):5'- TTCCCACTGGCACATGAAG -3'

Sequencing Primer
(F):5'- TATGCCTTGATTCAGGGACCAGAC -3'
(R):5'- TGCCAAAGAACTAGGACTACTG -3'

Posted On

2017-07-14