Mutagenetix > Incidental Mutation

Incidental Mutation 'R6051:Brca1'

484108

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

044219-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6051 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101524246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 160 (E160K)

Ref Sequence

ENSEMBL: ENSMUSP00000139737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

AlphaFold

P48754

Predicted Effect

probably damaging
Transcript: ENSMUST00000017290
AA Change: E1021K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: E1021K

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

probably damaging
Transcript: ENSMUST00000191198
AA Change: E160K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146
AA Change: E160K

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	G	T	1: 37,624,225	P864Q	probably damaging	Het
2310035C23Rik	G	T	1: 105,721,272	G712V	probably damaging	Het
2700049A03Rik	G	T	12: 71,184,530	A1021S	possibly damaging	Het
Abl2	A	G	1: 156,642,085	D869G	probably damaging	Het
Adamts9	A	G	6: 92,890,118	Y96H	probably damaging	Het
Adamts9	G	A	6: 92,859,926	A615V	possibly damaging	Het
Arhgef37	A	G	18: 61,507,274	I238T	probably damaging	Het
Atr	T	A	9: 95,908,369	H1587Q	possibly damaging	Het
BB014433	T	C	8: 15,042,179	T225A	possibly damaging	Het
Bcas2	T	C	3: 103,174,341	Y87H	possibly damaging	Het
Cd2ap	T	C	17: 42,796,328	*638W	probably null	Het
Chd2	A	T	7: 73,435,842	D1681E	probably benign	Het
Cit	C	T	5: 115,846,405	P12L	probably benign	Het
Crisp1	T	C	17: 40,305,126	Y120C	possibly damaging	Het
Cyp2c65	A	G	19: 39,061,166	D46G	probably benign	Het
Cyp2d34	A	T	15: 82,616,770	V387D	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,641	H194R	probably benign	Het
Egfr	C	A	11: 16,883,607	T625N	possibly damaging	Het
Fat3	A	G	9: 16,375,455	V924A	possibly damaging	Het
Fgd6	T	C	10: 94,137,565		probably null	Het
Galnt6	A	T	15: 100,694,668	C553S	probably damaging	Het
Gm5617	T	C	9: 48,495,887	L107P	possibly damaging	Het
Hectd1	G	T	12: 51,754,104	T2035N	probably benign	Het
Hp1bp3	A	G	4: 138,234,304	T154A	possibly damaging	Het
Il10rb	A	G	16: 91,421,864	T262A	probably benign	Het
Kansl1l	A	T	1: 66,726,726	N704K	probably null	Het
Kbtbd12	T	C	6: 88,617,948	D300G	possibly damaging	Het
Lama4	G	A	10: 39,067,902	A734T	probably benign	Het
Mllt6	G	T	11: 97,680,743	G1069*	probably null	Het
Mns1	T	C	9: 72,449,453	L302P	probably damaging	Het
Muc5ac	T	A	7: 141,811,857	C2039S	possibly damaging	Het
Myof	A	G	19: 38,024,361	L42P	probably damaging	Het
Ncoa3	T	C	2: 166,058,765	L868S	probably damaging	Het
Ndc80	C	T	17: 71,517,578	G212E	probably benign	Het
Ntn4	A	G	10: 93,745,795	H610R	probably benign	Het
Nufip2	T	A	11: 77,691,916	Y219N	probably damaging	Het
Olfr631	T	C	7: 103,928,877	F18S	probably damaging	Het
Pbxip1	T	C	3: 89,443,170	S41P	probably benign	Het
Phactr2	A	T	10: 13,261,811	C196S	probably null	Het
Ppp3ca	T	A	3: 136,876,122	Y140N	probably damaging	Het
Ptprb	C	A	10: 116,341,090	Y1260*	probably null	Het
Rap1a	C	T	3: 105,750,297	R2H	possibly damaging	Het
Rbbp8	G	A	18: 11,738,607	V794I	probably benign	Het
Rbks	T	C	5: 31,651,819	N200S	probably damaging	Het
Rnf186	G	T	4: 138,967,966	K272N	probably damaging	Het
Rtl1	G	A	12: 109,593,024	P794S	probably damaging	Het
Tbc1d30	T	A	10: 121,296,845	I205F	probably damaging	Het
Tkt	C	T	14: 30,568,196	P261S	probably benign	Het
Trp53	G	A	11: 69,589,608	R267H	possibly damaging	Het
Ttc14	T	C	3: 33,808,924		probably benign	Het
Ttn	A	G	2: 76,907,461	S4245P	probably benign	Het
Vmn1r75	A	T	7: 11,881,051	I237F	probably damaging	Het
Vmn2r57	T	A	7: 41,448,472	H57L	probably benign	Het
Wdr62	T	C	7: 30,261,384	N40S	possibly damaging	Het
Xcr1	A	T	9: 123,856,116	F194I	probably benign	Het
Zmiz1	T	A	14: 25,572,070	M1K	probably null	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTGCTCAAGATGGTCTGAG -3'
(R):5'- ACAATCAGTTTCTCCCATCAGGTC -3'

Sequencing Primer
(F):5'- TTGCTCAAGATGGTCTGAGAATAGAC -3'
(R):5'- TCCCATCAGGTCATCTATAAAAACTG -3'

Posted On

2017-07-14