Incidental Mutation 'R6051:Brca1'
ID 484108
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Name breast cancer 1, early onset
Synonyms
MMRRC Submission 044219-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6051 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 101488764-101551955 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101524246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 160 (E160K)
Ref Sequence ENSEMBL: ENSMUSP00000139737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
AlphaFold P48754
Predicted Effect probably damaging
Transcript: ENSMUST00000017290
AA Change: E1021K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: E1021K

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188168
Predicted Effect probably damaging
Transcript: ENSMUST00000191198
AA Change: E160K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146
AA Change: E160K

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G T 1: 37,624,225 P864Q probably damaging Het
2310035C23Rik G T 1: 105,721,272 G712V probably damaging Het
2700049A03Rik G T 12: 71,184,530 A1021S possibly damaging Het
Abl2 A G 1: 156,642,085 D869G probably damaging Het
Adamts9 A G 6: 92,890,118 Y96H probably damaging Het
Adamts9 G A 6: 92,859,926 A615V possibly damaging Het
Arhgef37 A G 18: 61,507,274 I238T probably damaging Het
Atr T A 9: 95,908,369 H1587Q possibly damaging Het
BB014433 T C 8: 15,042,179 T225A possibly damaging Het
Bcas2 T C 3: 103,174,341 Y87H possibly damaging Het
Cd2ap T C 17: 42,796,328 *638W probably null Het
Chd2 A T 7: 73,435,842 D1681E probably benign Het
Cit C T 5: 115,846,405 P12L probably benign Het
Crisp1 T C 17: 40,305,126 Y120C possibly damaging Het
Cyp2c65 A G 19: 39,061,166 D46G probably benign Het
Cyp2d34 A T 15: 82,616,770 V387D probably damaging Het
E130311K13Rik T C 3: 63,915,641 H194R probably benign Het
Egfr C A 11: 16,883,607 T625N possibly damaging Het
Fat3 A G 9: 16,375,455 V924A possibly damaging Het
Fgd6 T C 10: 94,137,565 probably null Het
Galnt6 A T 15: 100,694,668 C553S probably damaging Het
Gm5617 T C 9: 48,495,887 L107P possibly damaging Het
Hectd1 G T 12: 51,754,104 T2035N probably benign Het
Hp1bp3 A G 4: 138,234,304 T154A possibly damaging Het
Il10rb A G 16: 91,421,864 T262A probably benign Het
Kansl1l A T 1: 66,726,726 N704K probably null Het
Kbtbd12 T C 6: 88,617,948 D300G possibly damaging Het
Lama4 G A 10: 39,067,902 A734T probably benign Het
Mllt6 G T 11: 97,680,743 G1069* probably null Het
Mns1 T C 9: 72,449,453 L302P probably damaging Het
Muc5ac T A 7: 141,811,857 C2039S possibly damaging Het
Myof A G 19: 38,024,361 L42P probably damaging Het
Ncoa3 T C 2: 166,058,765 L868S probably damaging Het
Ndc80 C T 17: 71,517,578 G212E probably benign Het
Ntn4 A G 10: 93,745,795 H610R probably benign Het
Nufip2 T A 11: 77,691,916 Y219N probably damaging Het
Olfr631 T C 7: 103,928,877 F18S probably damaging Het
Pbxip1 T C 3: 89,443,170 S41P probably benign Het
Phactr2 A T 10: 13,261,811 C196S probably null Het
Ppp3ca T A 3: 136,876,122 Y140N probably damaging Het
Ptprb C A 10: 116,341,090 Y1260* probably null Het
Rap1a C T 3: 105,750,297 R2H possibly damaging Het
Rbbp8 G A 18: 11,738,607 V794I probably benign Het
Rbks T C 5: 31,651,819 N200S probably damaging Het
Rnf186 G T 4: 138,967,966 K272N probably damaging Het
Rtl1 G A 12: 109,593,024 P794S probably damaging Het
Tbc1d30 T A 10: 121,296,845 I205F probably damaging Het
Tkt C T 14: 30,568,196 P261S probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttc14 T C 3: 33,808,924 probably benign Het
Ttn A G 2: 76,907,461 S4245P probably benign Het
Vmn1r75 A T 7: 11,881,051 I237F probably damaging Het
Vmn2r57 T A 7: 41,448,472 H57L probably benign Het
Wdr62 T C 7: 30,261,384 N40S possibly damaging Het
Xcr1 A T 9: 123,856,116 F194I probably benign Het
Zmiz1 T A 14: 25,572,070 M1K probably null Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
BB002:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB009:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
BB012:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB019:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7925:Brca1 UTSW 11 101508146 missense probably benign 0.01
R7932:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
R8306:Brca1 UTSW 11 101525637 missense probably damaging 1.00
R8483:Brca1 UTSW 11 101525976 missense probably damaging 0.99
R8685:Brca1 UTSW 11 101489846 missense probably benign 0.19
R9072:Brca1 UTSW 11 101502480 critical splice donor site probably null
R9073:Brca1 UTSW 11 101502480 critical splice donor site probably null
R9486:Brca1 UTSW 11 101523694 missense probably benign 0.00
R9505:Brca1 UTSW 11 101512766 missense probably benign 0.00
R9616:Brca1 UTSW 11 101525857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGCTCAAGATGGTCTGAG -3'
(R):5'- ACAATCAGTTTCTCCCATCAGGTC -3'

Sequencing Primer
(F):5'- TTGCTCAAGATGGTCTGAGAATAGAC -3'
(R):5'- TCCCATCAGGTCATCTATAAAAACTG -3'
Posted On 2017-07-14