Incidental Mutation 'R6051:Tkt'
ID484113
Institutional Source Beutler Lab
Gene Symbol Tkt
Ensembl Gene ENSMUSG00000021957
Gene Nametransketolase
Synonymsp68
MMRRC Submission 044219-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6051 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30548359-30574720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30568196 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 261 (P261S)
Ref Sequence ENSEMBL: ENSMUSP00000022529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022529]
Predicted Effect probably benign
Transcript: ENSMUST00000022529
AA Change: P261S

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022529
Gene: ENSMUSG00000021957
AA Change: P261S

DomainStartEndE-ValueType
Pfam:Transketolase_N 14 284 1.4e-46 PFAM
Pfam:E1_dh 108 239 6.9e-11 PFAM
Transket_pyr 315 479 1.52e-42 SMART
Pfam:Transketolase_C 490 612 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223633
Predicted Effect probably benign
Transcript: ENSMUST00000223717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225857
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that binds magnesium and thiamine pyrophosphate and catalyzes the transfer of sugar phosphates to an aldose acceptor. This enzyme is a key component of the pentose phosphate pathway during glycolysis. It is significantly expressed in the cornea and may be involved in the cellular response against oxidative stress. Haploinsufficiency of this gene leads to decreased growth and reduction of adipose tissue. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation die at or before the morula stage. Heterozygotes show reduced growth, decreased fat accumulation, microphthalmia, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G T 1: 37,624,225 P864Q probably damaging Het
2310035C23Rik G T 1: 105,721,272 G712V probably damaging Het
2700049A03Rik G T 12: 71,184,530 A1021S possibly damaging Het
Abl2 A G 1: 156,642,085 D869G probably damaging Het
Adamts9 G A 6: 92,859,926 A615V possibly damaging Het
Adamts9 A G 6: 92,890,118 Y96H probably damaging Het
Arhgef37 A G 18: 61,507,274 I238T probably damaging Het
Atr T A 9: 95,908,369 H1587Q possibly damaging Het
BB014433 T C 8: 15,042,179 T225A possibly damaging Het
Bcas2 T C 3: 103,174,341 Y87H possibly damaging Het
Brca1 C T 11: 101,524,246 E160K probably damaging Het
Cd2ap T C 17: 42,796,328 *638W probably null Het
Chd2 A T 7: 73,435,842 D1681E probably benign Het
Cit C T 5: 115,846,405 P12L probably benign Het
Crisp1 T C 17: 40,305,126 Y120C possibly damaging Het
Cyp2c65 A G 19: 39,061,166 D46G probably benign Het
Cyp2d34 A T 15: 82,616,770 V387D probably damaging Het
E130311K13Rik T C 3: 63,915,641 H194R probably benign Het
Egfr C A 11: 16,883,607 T625N possibly damaging Het
Fat3 A G 9: 16,375,455 V924A possibly damaging Het
Fgd6 T C 10: 94,137,565 probably null Het
Galnt6 A T 15: 100,694,668 C553S probably damaging Het
Gm5617 T C 9: 48,495,887 L107P possibly damaging Het
Hectd1 G T 12: 51,754,104 T2035N probably benign Het
Hp1bp3 A G 4: 138,234,304 T154A possibly damaging Het
Il10rb A G 16: 91,421,864 T262A probably benign Het
Kansl1l A T 1: 66,726,726 N704K probably null Het
Kbtbd12 T C 6: 88,617,948 D300G possibly damaging Het
Lama4 G A 10: 39,067,902 A734T probably benign Het
Mllt6 G T 11: 97,680,743 G1069* probably null Het
Mns1 T C 9: 72,449,453 L302P probably damaging Het
Muc5ac T A 7: 141,811,857 C2039S possibly damaging Het
Myof A G 19: 38,024,361 L42P probably damaging Het
Ncoa3 T C 2: 166,058,765 L868S probably damaging Het
Ndc80 C T 17: 71,517,578 G212E probably benign Het
Ntn4 A G 10: 93,745,795 H610R probably benign Het
Nufip2 T A 11: 77,691,916 Y219N probably damaging Het
Olfr631 T C 7: 103,928,877 F18S probably damaging Het
Pbxip1 T C 3: 89,443,170 S41P probably benign Het
Phactr2 A T 10: 13,261,811 C196S probably null Het
Ppp3ca T A 3: 136,876,122 Y140N probably damaging Het
Ptprb C A 10: 116,341,090 Y1260* probably null Het
Rap1a C T 3: 105,750,297 R2H possibly damaging Het
Rbbp8 G A 18: 11,738,607 V794I probably benign Het
Rbks T C 5: 31,651,819 N200S probably damaging Het
Rnf186 G T 4: 138,967,966 K272N probably damaging Het
Rtl1 G A 12: 109,593,024 P794S probably damaging Het
Tbc1d30 T A 10: 121,296,845 I205F probably damaging Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttc14 T C 3: 33,808,924 probably benign Het
Ttn A G 2: 76,907,461 S4245P probably benign Het
Vmn1r75 A T 7: 11,881,051 I237F probably damaging Het
Vmn2r57 T A 7: 41,448,472 H57L probably benign Het
Wdr62 T C 7: 30,261,384 N40S possibly damaging Het
Xcr1 A T 9: 123,856,116 F194I probably benign Het
Zmiz1 T A 14: 25,572,070 M1K probably null Het
Other mutations in Tkt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tkt APN 14 30569095 missense probably damaging 1.00
IGL02122:Tkt APN 14 30571201 missense possibly damaging 0.95
IGL02323:Tkt APN 14 30571035 missense possibly damaging 0.69
IGL02326:Tkt APN 14 30572225 missense probably damaging 0.99
IGL02554:Tkt APN 14 30558780 missense probably damaging 1.00
IGL03145:Tkt APN 14 30560688 splice site probably benign
R0148:Tkt UTSW 14 30572220 missense probably damaging 1.00
R0732:Tkt UTSW 14 30571140 splice site probably null
R1550:Tkt UTSW 14 30565568 missense probably damaging 1.00
R2218:Tkt UTSW 14 30567061 critical splice donor site probably null
R4464:Tkt UTSW 14 30568274 missense possibly damaging 0.86
R4771:Tkt UTSW 14 30567025 missense probably damaging 0.97
R4998:Tkt UTSW 14 30565542 nonsense probably null
R5123:Tkt UTSW 14 30565646 missense probably benign 0.11
R5240:Tkt UTSW 14 30565678 missense probably damaging 1.00
R5283:Tkt UTSW 14 30560618 missense probably damaging 1.00
R5777:Tkt UTSW 14 30558776 missense possibly damaging 0.88
R6517:Tkt UTSW 14 30549323 missense probably damaging 0.96
R6645:Tkt UTSW 14 30570211 missense probably damaging 1.00
R6722:Tkt UTSW 14 30569084 missense probably damaging 1.00
R7120:Tkt UTSW 14 30559822 missense probably benign 0.03
R7179:Tkt UTSW 14 30559858 missense probably damaging 1.00
R7272:Tkt UTSW 14 30565607 missense probably damaging 1.00
R7274:Tkt UTSW 14 30569145 splice site probably null
R7402:Tkt UTSW 14 30558798 missense probably damaging 1.00
R7423:Tkt UTSW 14 30571035 missense possibly damaging 0.69
R7522:Tkt UTSW 14 30568223 missense possibly damaging 0.52
R7712:Tkt UTSW 14 30558806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGACAAGGATGTGGAGCC -3'
(R):5'- AGAGCCATCCAGGTACCTTG -3'

Sequencing Primer
(F):5'- CACATCTGCCTCCACATGG -3'
(R):5'- GTCCCCCACTTTGTAGCTGGG -3'
Posted On2017-07-14