Incidental Mutation 'R6052:Dnah14'
ID 484128
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 044220-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6052 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 181494052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1736 (V1736A)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194470
Predicted Effect possibly damaging
Transcript: ENSMUST00000208001
AA Change: V1736A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,537,165 (GRCm39) F473L probably benign Het
Ankrd17 T C 5: 90,401,691 (GRCm39) I1449V probably benign Het
Aox4 T A 1: 58,293,477 (GRCm39) L943* probably null Het
Arap1 G A 7: 101,053,240 (GRCm39) V1257M probably damaging Het
B3gnt9 T C 8: 105,981,230 (GRCm39) S53G probably benign Het
Baiap3 A T 17: 25,467,444 (GRCm39) probably benign Het
Canx T C 11: 50,187,946 (GRCm39) D554G possibly damaging Het
Cbfa2t2 T C 2: 154,352,501 (GRCm39) V165A probably damaging Het
Ccdc17 C T 4: 116,457,145 (GRCm39) probably null Het
Cdcp1 A G 9: 123,014,396 (GRCm39) I126T probably benign Het
Cdk13 A T 13: 17,895,800 (GRCm39) D1036E probably damaging Het
Cfap157 A G 2: 32,669,863 (GRCm39) L240P probably damaging Het
Clec18a C A 8: 111,805,448 (GRCm39) E218* probably null Het
Col3a1 T C 1: 45,384,173 (GRCm39) probably benign Het
Dennd4a A G 9: 64,794,227 (GRCm39) E682G probably damaging Het
Dpep2 T A 8: 106,717,270 (GRCm39) D162V possibly damaging Het
Drd3 C A 16: 43,641,646 (GRCm39) P321T probably benign Het
Egfr A G 11: 16,861,554 (GRCm39) H1111R probably benign Het
Entpd1 T C 19: 40,708,928 (GRCm39) S58P probably damaging Het
Epha3 C A 16: 63,423,967 (GRCm39) V541L possibly damaging Het
Eri3 T A 4: 117,421,825 (GRCm39) D34E probably damaging Het
Eya1 T C 1: 14,353,374 (GRCm39) D58G probably damaging Het
Fat3 T A 9: 15,833,975 (GRCm39) S26C probably null Het
Fgl1 T C 8: 41,653,548 (GRCm39) D115G probably damaging Het
Fitm2 T C 2: 163,312,036 (GRCm39) Y59C probably damaging Het
Fras1 T A 5: 96,912,725 (GRCm39) I3343N probably damaging Het
Gba2 C A 4: 43,568,330 (GRCm39) C679F probably damaging Het
Glis2 G A 16: 4,431,603 (GRCm39) probably benign Het
Gm5150 T A 3: 16,044,917 (GRCm39) I103F probably damaging Het
Hhipl2 T C 1: 183,204,965 (GRCm39) S313P possibly damaging Het
Hmgcs1 A G 13: 120,166,995 (GRCm39) D474G probably benign Het
Homer3 C T 8: 70,744,076 (GRCm39) Q267* probably null Het
Hsd17b8 A G 17: 34,246,429 (GRCm39) L118P probably damaging Het
Igkv8-28 C T 6: 70,120,673 (GRCm39) G90D probably damaging Het
Kalrn T A 16: 34,181,255 (GRCm39) I128F probably damaging Het
Krt4 A G 15: 101,831,194 (GRCm39) probably null Het
Lamb2 T A 9: 108,364,811 (GRCm39) C1188* probably null Het
Lsr A T 7: 30,658,042 (GRCm39) M355K probably damaging Het
Map3k11 T G 19: 5,747,430 (GRCm39) D555E probably benign Het
Myocd A G 11: 65,087,082 (GRCm39) Y282H probably damaging Het
Nae1 T C 8: 105,261,176 (GRCm39) I7M probably benign Het
Nprl3 G T 11: 32,205,453 (GRCm39) H102N possibly damaging Het
Nup62 T A 7: 44,478,464 (GRCm39) F160I possibly damaging Het
Or10w1 C A 19: 13,631,871 (GRCm39) P26Q possibly damaging Het
Or2d3c A T 7: 106,525,896 (GRCm39) F257I probably benign Het
Or2r2 T A 6: 42,463,588 (GRCm39) T180S possibly damaging Het
Or5p76 A G 7: 108,122,945 (GRCm39) S71P probably benign Het
Or6c35 C A 10: 129,169,071 (GRCm39) T107K possibly damaging Het
Osbpl10 T C 9: 114,896,383 (GRCm39) probably null Het
Pcdh9 C T 14: 94,123,282 (GRCm39) V963I probably benign Het
Phf12 A G 11: 77,909,044 (GRCm39) R375G probably benign Het
Piezo1 G A 8: 123,233,008 (GRCm39) T108M probably damaging Het
Plxnc1 T A 10: 94,779,635 (GRCm39) Q269L probably benign Het
Pomgnt1 T A 4: 116,008,799 (GRCm39) N11K possibly damaging Het
Pramel22 T A 4: 143,382,222 (GRCm39) D158V probably damaging Het
Prkd1 A T 12: 50,413,083 (GRCm39) probably null Het
Prpf40a T C 2: 53,049,293 (GRCm39) T190A probably benign Het
Prrc2b A C 2: 32,102,297 (GRCm39) H790P possibly damaging Het
Rest T G 5: 77,429,027 (GRCm39) V482G probably benign Het
Ros1 T A 10: 52,039,999 (GRCm39) I322L probably benign Het
Rpl18 G A 7: 45,369,554 (GRCm39) probably benign Het
Rsad2 G A 12: 26,500,577 (GRCm39) H237Y probably benign Het
Sbf2 A G 7: 110,040,741 (GRCm39) L362S probably damaging Het
Sgsm3 A G 15: 80,893,464 (GRCm39) T409A probably benign Het
Slc16a14 T C 1: 84,890,430 (GRCm39) T292A possibly damaging Het
Spg11 T G 2: 121,927,837 (GRCm39) K649T probably damaging Het
Srprb T A 9: 103,067,415 (GRCm39) I268F possibly damaging Het
Tap2 G A 17: 34,433,683 (GRCm39) G566S probably damaging Het
Tecpr2 T C 12: 110,885,325 (GRCm39) V168A possibly damaging Het
Tln1 G C 4: 43,555,052 (GRCm39) F259L probably damaging Het
Tmem181a T A 17: 6,330,890 (GRCm39) L50H probably damaging Het
Tshz1 A G 18: 84,032,194 (GRCm39) I738T probably damaging Het
Tspan12 T C 6: 21,772,637 (GRCm39) E304G probably benign Het
Urb1 C T 16: 90,559,271 (GRCm39) G1671S probably damaging Het
Vmn2r2 T C 3: 64,024,782 (GRCm39) S600G possibly damaging Het
Wnt3 C A 11: 103,699,000 (GRCm39) Y35* probably null Het
Xpo7 T C 14: 70,921,159 (GRCm39) Y603C possibly damaging Het
Zfp457 G A 13: 67,442,015 (GRCm39) H91Y probably damaging Het
Zfp664 T A 5: 124,963,250 (GRCm39) C215S unknown Het
Zfp882 G A 8: 72,668,349 (GRCm39) G392D probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCTCAAAGGACAGTCTTC -3'
(R):5'- AGTGTGCTTAATGATCCTTCCAC -3'

Sequencing Primer
(F):5'- TGCTCAAAGGACAGTCTTCTAACCTG -3'
(R):5'- AATGATCCTTCCACTCCCCTGG -3'
Posted On 2017-07-14