Incidental Mutation 'R6052:B3gnt9'
ID484160
Institutional Source Beutler Lab
Gene Symbol B3gnt9
Ensembl Gene ENSMUSG00000069920
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Synonyms
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6052 (G1)
Quality Score134.008
Status Validated
Chromosome8
Chromosomal Location105252638-105255153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105254598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 53 (S53G)
Ref Sequence ENSEMBL: ENSMUSP00000125145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034359] [ENSMUST00000034361] [ENSMUST00000093217] [ENSMUST00000124113] [ENSMUST00000136822] [ENSMUST00000141957] [ENSMUST00000144762] [ENSMUST00000161745]
Predicted Effect probably benign
Transcript: ENSMUST00000034359
SMART Domains Protein: ENSMUSP00000034359
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
Pfam:TRADD_N 51 161 2.9e-49 PFAM
DEATH 203 303 1.14e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034361
SMART Domains Protein: ENSMUSP00000034361
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 15 407 1.7e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093217
AA Change: S53G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133023
Gene: ENSMUSG00000069920
AA Change: S53G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124113
SMART Domains Protein: ENSMUSP00000119743
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 120 1.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136239
Predicted Effect probably benign
Transcript: ENSMUST00000136822
AA Change: S53G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130840
Gene: ENSMUSG00000069920
AA Change: S53G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141957
SMART Domains Protein: ENSMUSP00000119148
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 161 2.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144762
SMART Domains Protein: ENSMUSP00000119174
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 50 7e-23 PDB
SCOP:d1f3va_ 8 50 4e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156561
Predicted Effect probably benign
Transcript: ENSMUST00000161745
AA Change: S53G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125145
Gene: ENSMUSG00000069920
AA Change: S53G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in B3gnt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0687:B3gnt9 UTSW 8 105254783 start gained probably benign
R1342:B3gnt9 UTSW 8 105254324 missense probably null 1.00
R2378:B3gnt9 UTSW 8 105254484 missense probably damaging 1.00
R4622:B3gnt9 UTSW 8 105253845 missense probably benign 0.04
R4931:B3gnt9 UTSW 8 105254244 missense probably benign
R5007:B3gnt9 UTSW 8 105254490 missense probably damaging 1.00
R6440:B3gnt9 UTSW 8 105253899 splice site probably null
R7159:B3gnt9 UTSW 8 105254432 missense probably damaging 1.00
R7558:B3gnt9 UTSW 8 105254672 missense probably benign 0.23
R8341:B3gnt9 UTSW 8 105253865 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACAGACTTGACAGCGATGAG -3'
(R):5'- CTGGAGCTGAGGTTAGAAGC -3'

Sequencing Primer
(F):5'- ATGAGCAGGTCCGGCGAAC -3'
(R):5'- AGAAGCTGAACTTTTTGTCCCTTAGG -3'
Posted On2017-07-14