Incidental Mutation 'R6052:Clec18a'
ID484162
Institutional Source Beutler Lab
Gene Symbol Clec18a
Ensembl Gene ENSMUSG00000033633
Gene NameC-type lectin domain family 18, member A
SynonymsMrcl
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111058920-111092426 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 111078816 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 218 (E218*)
Ref Sequence ENSEMBL: ENSMUSP00000139515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039597] [ENSMUST00000186384] [ENSMUST00000188466] [ENSMUST00000190222] [ENSMUST00000190778] [ENSMUST00000191030] [ENSMUST00000191469]
Predicted Effect probably null
Transcript: ENSMUST00000039597
AA Change: E218*
SMART Domains Protein: ENSMUSP00000046546
Gene: ENSMUSG00000033633
AA Change: E218*

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
SCP 130 278 5.76e-19 SMART
EGF 312 349 5.32e-1 SMART
EGF_like 351 380 4.83e1 SMART
CLECT 385 521 4.65e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186384
Predicted Effect probably null
Transcript: ENSMUST00000188466
AA Change: E157*
SMART Domains Protein: ENSMUSP00000141073
Gene: ENSMUSG00000033633
AA Change: E157*

DomainStartEndE-ValueType
signal peptide 1 53 N/A INTRINSIC
SCP 69 217 2.8e-21 SMART
EGF 251 288 2.6e-3 SMART
EGF_like 290 319 2.4e-1 SMART
CLECT 324 460 2.3e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190222
AA Change: E157*
SMART Domains Protein: ENSMUSP00000139634
Gene: ENSMUSG00000033633
AA Change: E157*

DomainStartEndE-ValueType
signal peptide 1 53 N/A INTRINSIC
SCP 69 217 2.8e-21 SMART
EGF 251 288 2.6e-3 SMART
EGF_like 290 319 2.4e-1 SMART
Pfam:Lectin_C 343 418 1.7e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190778
SMART Domains Protein: ENSMUSP00000139789
Gene: ENSMUSG00000033633

DomainStartEndE-ValueType
low complexity region 59 80 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191030
AA Change: E188*
SMART Domains Protein: ENSMUSP00000139569
Gene: ENSMUSG00000033633
AA Change: E188*

DomainStartEndE-ValueType
low complexity region 59 80 N/A INTRINSIC
SCP 100 248 5.76e-19 SMART
EGF 282 319 5.32e-1 SMART
EGF_like 321 350 4.83e1 SMART
CLECT 355 491 4.65e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191469
AA Change: E218*
SMART Domains Protein: ENSMUSP00000139515
Gene: ENSMUSG00000033633
AA Change: E218*

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
SCP 130 278 5.76e-19 SMART
EGF 312 349 5.32e-1 SMART
EGF_like 351 380 4.83e1 SMART
CLECT 385 521 4.65e-20 SMART
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Clec18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Clec18a APN 8 111071613 missense probably damaging 1.00
LCD18:Clec18a UTSW 8 111076136 splice site probably benign
R1251:Clec18a UTSW 8 111081638 missense possibly damaging 0.46
R1528:Clec18a UTSW 8 111078866 missense probably benign 0.00
R1994:Clec18a UTSW 8 111081602 missense possibly damaging 0.90
R2283:Clec18a UTSW 8 111075508 missense probably benign 0.33
R4458:Clec18a UTSW 8 111075470 missense probably damaging 1.00
R4790:Clec18a UTSW 8 111072085 missense probably damaging 1.00
R5249:Clec18a UTSW 8 111073736 missense probably damaging 1.00
R5848:Clec18a UTSW 8 111075461 missense probably benign 0.24
R5862:Clec18a UTSW 8 111081558 missense possibly damaging 0.46
R6361:Clec18a UTSW 8 111081029 intron probably benign
R6786:Clec18a UTSW 8 111080940 missense probably benign 0.00
R7220:Clec18a UTSW 8 111081572 missense probably benign 0.00
R8074:Clec18a UTSW 8 111071598 missense probably damaging 0.99
R8157:Clec18a UTSW 8 111072051 missense probably damaging 1.00
R8170:Clec18a UTSW 8 111080919 missense probably damaging 0.98
R8309:Clec18a UTSW 8 111082057 missense probably benign 0.08
R8945:Clec18a UTSW 8 111081569 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACAGTGCTCTGGTGTGGTAAC -3'
(R):5'- AGCGAATGTATCATCTGAGGATGTC -3'

Sequencing Primer
(F):5'- GTAACATCTAAATCTAGACAGTGTCC -3'
(R):5'- TTGCCACTCCCAGGACTG -3'
Posted On2017-07-14