Mutagenetix > Incidental Mutations

Incidental Mutation 'R6052:Egfr'

484173

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

044220-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R6052 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16911554 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1111 (H1111R)

Ref Sequence

ENSEMBL: ENSMUSP00000020329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329]

Predicted Effect

probably benign
Transcript: ENSMUST00000020329
AA Change: H1111R

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: H1111R

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138518

Meta Mutation Damage Score

0.0711

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.7%

Validation Efficiency

96% (80/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	A	G	17: 24,318,191	F473L	probably benign	Het
Ankrd17	T	C	5: 90,253,832	I1449V	probably benign	Het
Aox4	T	A	1: 58,254,318	L943*	probably null	Het
Arap1	G	A	7: 101,404,033	V1257M	probably damaging	Het
B3gnt9	T	C	8: 105,254,598	S53G	probably benign	Het
Baiap3	A	T	17: 25,248,470		probably benign	Het
Canx	T	C	11: 50,297,119	D554G	possibly damaging	Het
Cbfa2t2	T	C	2: 154,510,581	V165A	probably damaging	Het
Ccdc17	C	T	4: 116,599,948		probably null	Het
Cdcp1	A	G	9: 123,185,331	I126T	probably benign	Het
Cdk13	A	T	13: 17,721,215	D1036E	probably damaging	Het
Cfap157	A	G	2: 32,779,851	L240P	probably damaging	Het
Clec18a	C	A	8: 111,078,816	E218*	probably null	Het
Col3a1	T	C	1: 45,345,013		probably benign	Het
Dennd4a	A	G	9: 64,886,945	E682G	probably damaging	Het
Dnah14	T	C	1: 181,666,487	V1736A	possibly damaging	Het
Dpep2	T	A	8: 105,990,638	D162V	possibly damaging	Het
Drd3	C	A	16: 43,821,283	P321T	probably benign	Het
Entpd1	T	C	19: 40,720,484	S58P	probably damaging	Het
Epha3	C	A	16: 63,603,604	V541L	possibly damaging	Het
Eri3	T	A	4: 117,564,628	D34E	probably damaging	Het
Eya1	T	C	1: 14,283,150	D58G	probably damaging	Het
Fat3	T	A	9: 15,922,679	S26C	probably null	Het
Fgl1	T	C	8: 41,200,511	D115G	probably damaging	Het
Fitm2	T	C	2: 163,470,116	Y59C	probably damaging	Het
Fras1	T	A	5: 96,764,866	I3343N	probably damaging	Het
Gba2	C	A	4: 43,568,330	C679F	probably damaging	Het
Glis2	G	A	16: 4,613,739		probably benign	Het
Gm13088	T	A	4: 143,655,652	D158V	probably damaging	Het
Gm5150	T	A	3: 15,990,753	I103F	probably damaging	Het
H2-Ke6	A	G	17: 34,027,455	L118P	probably damaging	Het
Hhipl2	T	C	1: 183,424,057	S313P	possibly damaging	Het
Hmgcs1	A	G	13: 119,705,459	D474G	probably benign	Het
Homer3	C	T	8: 70,291,426	Q267*	probably null	Het
Igkv8-28	C	T	6: 70,143,689	G90D	probably damaging	Het
Kalrn	T	A	16: 34,360,885	I128F	probably damaging	Het
Krt4	A	G	15: 101,922,759		probably null	Het
Lamb2	T	A	9: 108,487,612	C1188*	probably null	Het
Lsr	A	T	7: 30,958,617	M355K	probably damaging	Het
Map3k11	T	G	19: 5,697,402	D555E	probably benign	Het
Myocd	A	G	11: 65,196,256	Y282H	probably damaging	Het
Nae1	T	C	8: 104,534,544	I7M	probably benign	Het
Nprl3	G	T	11: 32,255,453	H102N	possibly damaging	Het
Nup62	T	A	7: 44,829,040	F160I	possibly damaging	Het
Olfr1490	C	A	19: 13,654,507	P26Q	possibly damaging	Het
Olfr456	T	A	6: 42,486,654	T180S	possibly damaging	Het
Olfr502	A	G	7: 108,523,738	S71P	probably benign	Het
Olfr709-ps1	A	T	7: 106,926,689	F257I	probably benign	Het
Olfr781	C	A	10: 129,333,202	T107K	possibly damaging	Het
Osbpl10	T	C	9: 115,067,315		probably null	Het
Pcdh9	C	T	14: 93,885,846	V963I	probably benign	Het
Phf12	A	G	11: 78,018,218	R375G	probably benign	Het
Piezo1	G	A	8: 122,506,269	T108M	probably damaging	Het
Plxnc1	T	A	10: 94,943,773	Q269L	probably benign	Het
Pomgnt1	T	A	4: 116,151,602	N11K	possibly damaging	Het
Prkd1	A	T	12: 50,366,300		probably null	Het
Prpf40a	T	C	2: 53,159,281	T190A	probably benign	Het
Prrc2b	A	C	2: 32,212,285	H790P	possibly damaging	Het
Rest	T	G	5: 77,281,180	V482G	probably benign	Het
Ros1	T	A	10: 52,163,903	I322L	probably benign	Het
Rpl18	G	A	7: 45,720,130		probably benign	Het
Rsad2	G	A	12: 26,450,578	H237Y	probably benign	Het
Sbf2	A	G	7: 110,441,534	L362S	probably damaging	Het
Sgsm3	A	G	15: 81,009,263	T409A	probably benign	Het
Slc16a14	T	C	1: 84,912,709	T292A	possibly damaging	Het
Spg11	T	G	2: 122,097,356	K649T	probably damaging	Het
Srprb	T	A	9: 103,190,216	I268F	possibly damaging	Het
Tap2	G	A	17: 34,214,709	G566S	probably damaging	Het
Tecpr2	T	C	12: 110,918,891	V168A	possibly damaging	Het
Tln1	G	C	4: 43,555,052	F259L	probably damaging	Het
Tmem181a	T	A	17: 6,280,615	L50H	probably damaging	Het
Tshz1	A	G	18: 84,014,069	I738T	probably damaging	Het
Tspan12	T	C	6: 21,772,638	E304G	probably benign	Het
Urb1	C	T	16: 90,762,383	G1671S	probably damaging	Het
Vmn2r2	T	C	3: 64,117,361	S600G	possibly damaging	Het
Wnt3	C	A	11: 103,808,174	Y35*	probably null	Het
Xpo7	T	C	14: 70,683,719	Y603C	possibly damaging	Het
Zfp457	G	A	13: 67,293,951	H91Y	probably damaging	Het
Zfp664	T	A	5: 124,886,186	C215S	unknown	Het
Zfp882	G	A	8: 71,914,505	G392D	probably benign	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTGTTCCCAGAACTTCCTTG -3'
(R):5'- AAGTCCTGCTGGTAGTCAGG -3'

Sequencing Primer
(F):5'- AGAACTTCCTTGCTCTTGGATATCGG -3'
(R):5'- AGTCAGGGTTGTCTAGGCTC -3'

Posted On

2017-07-14