Incidental Mutation 'R6052:Sgsm3'
ID484187
Institutional Source Beutler Lab
Gene Symbol Sgsm3
Ensembl Gene ENSMUSG00000042303
Gene Namesmall G protein signaling modulator 3
SynonymsCIP85, Rutbc3, 1810012I01Rik
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location80977765-81012290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81009263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 409 (T409A)
Ref Sequence ENSEMBL: ENSMUSP00000122543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000137255] [ENSMUST00000139517] [ENSMUST00000143147] [ENSMUST00000149582] [ENSMUST00000228971] [ENSMUST00000229727]
PDB Structure Solution structure of the SH3 domain of mouse RUN and TBC1 domain containing 3 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042506
AA Change: T419A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043311
Gene: ENSMUSG00000103565
AA Change: T419A

DomainStartEndE-ValueType
TBC 121 338 3.6e-62 SMART
low complexity region 391 401 N/A INTRINSIC
SH3 493 548 6.34e-19 SMART
RUN 664 726 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109579
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124845
AA Change: T336A
Predicted Effect probably benign
Transcript: ENSMUST00000131235
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132039
Predicted Effect probably benign
Transcript: ENSMUST00000134469
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134559
Predicted Effect probably benign
Transcript: ENSMUST00000137255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138550
Predicted Effect probably benign
Transcript: ENSMUST00000139517
AA Change: T409A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303
AA Change: T409A

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143147
Predicted Effect unknown
Transcript: ENSMUST00000154904
AA Change: T39A
SMART Domains Protein: ENSMUSP00000118050
Gene: ENSMUSG00000042303
AA Change: T39A

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
SH3 114 169 6.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156783
Predicted Effect probably benign
Transcript: ENSMUST00000149582
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230118
Predicted Effect probably benign
Transcript: ENSMUST00000228971
Predicted Effect probably benign
Transcript: ENSMUST00000229727
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Sgsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Sgsm3 APN 15 81010852 unclassified probably benign
IGL03370:Sgsm3 APN 15 81011654 critical splice acceptor site probably null
R0109:Sgsm3 UTSW 15 81009466 missense probably damaging 0.99
R0267:Sgsm3 UTSW 15 81006602 missense probably damaging 0.96
R0382:Sgsm3 UTSW 15 81008314 nonsense probably null
R0441:Sgsm3 UTSW 15 81009770 missense possibly damaging 0.87
R0631:Sgsm3 UTSW 15 81011736 makesense probably null
R0905:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R1364:Sgsm3 UTSW 15 81007942 missense probably damaging 0.98
R1515:Sgsm3 UTSW 15 81010256 missense probably benign 0.08
R2226:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2227:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2414:Sgsm3 UTSW 15 81006745 missense probably benign 0.10
R2508:Sgsm3 UTSW 15 81003872 critical splice donor site probably null
R4240:Sgsm3 UTSW 15 81011782 unclassified probably benign
R4302:Sgsm3 UTSW 15 81010301 unclassified probably benign
R4899:Sgsm3 UTSW 15 81006779 missense probably benign 0.13
R5234:Sgsm3 UTSW 15 81007944 missense probably damaging 1.00
R5288:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5385:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5386:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5682:Sgsm3 UTSW 15 81011460 critical splice acceptor site probably null
R6349:Sgsm3 UTSW 15 81008346 missense probably benign 0.00
R6453:Sgsm3 UTSW 15 81011314 missense probably damaging 0.96
R6486:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R6591:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6642:Sgsm3 UTSW 15 81009700 missense probably damaging 0.99
R6691:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6897:Sgsm3 UTSW 15 81008894 missense probably benign 0.00
R7038:Sgsm3 UTSW 15 81008375 missense possibly damaging 0.86
R7390:Sgsm3 UTSW 15 81008820 missense possibly damaging 0.77
R7572:Sgsm3 UTSW 15 81007466 missense possibly damaging 0.78
R7730:Sgsm3 UTSW 15 81008726 missense probably damaging 1.00
R7851:Sgsm3 UTSW 15 81010753 missense probably damaging 1.00
R8186:Sgsm3 UTSW 15 81009442 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGAAGATACGCCTTGATGTGAGAG -3'
(R):5'- CACACGCAAAATGGCTTCGC -3'

Sequencing Primer
(F):5'- TGAGAGTCAGCTTCAGCCATTAG -3'
(R):5'- TAACAGGTCCTGCCGAAT -3'
Posted On2017-07-14