Incidental Mutation 'R6052:Glis2'
ID484189
Institutional Source Beutler Lab
Gene Symbol Glis2
Ensembl Gene ENSMUSG00000014303
Gene NameGLIS family zinc finger 2
SynonymsNkl
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4594713-4624924 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 4613739 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014445] [ENSMUST00000014447] [ENSMUST00000141682] [ENSMUST00000156889]
Predicted Effect probably benign
Transcript: ENSMUST00000014445
SMART Domains Protein: ENSMUSP00000014445
Gene: ENSMUSG00000014301

DomainStartEndE-ValueType
Pfam:Pam16 1 125 4.9e-63 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000014447
AA Change: G377S
SMART Domains Protein: ENSMUSP00000014447
Gene: ENSMUSG00000014303
AA Change: G377S

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
ZnF_C2H2 168 193 1.05e1 SMART
ZnF_C2H2 202 229 8.09e0 SMART
ZnF_C2H2 235 257 1.82e-3 SMART
ZnF_C2H2 263 287 3.16e-3 SMART
ZnF_C2H2 293 317 1.04e-3 SMART
low complexity region 328 342 N/A INTRINSIC
low complexity region 358 385 N/A INTRINSIC
low complexity region 387 402 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
low complexity region 420 445 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139534
Predicted Effect probably benign
Transcript: ENSMUST00000141682
SMART Domains Protein: ENSMUSP00000115728
Gene: ENSMUSG00000014303

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156889
Meta Mutation Damage Score 0.1455 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear transcription factor with five C2H2-type zinc finger domains. The protein encoded by this gene is widely expressed at low levels in the neural tube and peripheral nervous system and likely promotes neuronal differentiation. It is abundantly expressed in the kidney and may have a role in the regulation of kidney morphogenesis. p120 regulates the expression level of this protein and induces the cleavage of this protein's C-terminal zinc finger domain. This protein also promotes the nuclear translocation of p120. Mutations in this gene cause nephronophthisis (NPHP), an autosomal recessive kidney disease characterized by tubular basement membrane disruption, interstitial lymphohistiocytic cell infiltration, and development of cysts at the corticomedullary border of the kidneys.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a fusion allele exhibit decreased kidney weight, kidney atrophy, kidney cysts, and interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Glis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Glis2 APN 16 4611650 missense probably damaging 1.00
IGL01680:Glis2 APN 16 4611331 missense possibly damaging 0.82
IGL02055:Glis2 APN 16 4614108 unclassified probably benign
IGL02802:Glis2 UTSW 16 4611871 critical splice donor site probably null
R0081:Glis2 UTSW 16 4613653 missense probably benign 0.22
R0517:Glis2 UTSW 16 4611552 missense probably damaging 0.98
R2010:Glis2 UTSW 16 4608711 missense probably damaging 0.99
R2145:Glis2 UTSW 16 4613642 missense possibly damaging 0.79
R3780:Glis2 UTSW 16 4613896 unclassified probably benign
R4180:Glis2 UTSW 16 4611376 missense probably benign 0.04
R5213:Glis2 UTSW 16 4614082 unclassified probably benign
R6012:Glis2 UTSW 16 4611308 missense possibly damaging 0.76
R6214:Glis2 UTSW 16 4610333 nonsense probably null
R6215:Glis2 UTSW 16 4610333 nonsense probably null
R6316:Glis2 UTSW 16 4613836 unclassified probably benign
R7172:Glis2 UTSW 16 4613475 missense probably benign 0.32
R7286:Glis2 UTSW 16 4611318 missense possibly damaging 0.93
R7346:Glis2 UTSW 16 4613568 missense possibly damaging 0.83
R7816:Glis2 UTSW 16 4613464 missense probably damaging 1.00
X0020:Glis2 UTSW 16 4608653 missense probably damaging 1.00
X0027:Glis2 UTSW 16 4611457 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGTCACATGAGCAGCAGG -3'
(R):5'- TTGTGATCTTCCAGGCCCAG -3'

Sequencing Primer
(F):5'- TGACAGTGGCTCCTATGT -3'
(R):5'- GGTACTGACCCACGACCCTTC -3'
Posted On2017-07-14