Incidental Mutation 'R6052:Drd3'
ID484191
Institutional Source Beutler Lab
Gene Symbol Drd3
Ensembl Gene ENSMUSG00000022705
Gene Namedopamine receptor D3
SynonymsD3 receptor, D3R
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location43754026-43822932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43821283 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 321 (P321T)
Ref Sequence ENSEMBL: ENSMUSP00000155033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023390] [ENSMUST00000229953]
Predicted Effect probably benign
Transcript: ENSMUST00000023390
AA Change: P289T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023390
Gene: ENSMUSG00000022705
AA Change: P289T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 234 4.5e-9 PFAM
Pfam:7tm_1 46 429 5.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229953
AA Change: P321T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show exploratory hyperactivity and increased locomotion and rearing behavior, with heterozygous mice displaying similar, but less pronounced, behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Drd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Drd3 APN 16 43762321 missense probably benign 0.01
IGL01715:Drd3 APN 16 43821268 missense probably damaging 0.98
IGL01944:Drd3 APN 16 43818308 missense probably benign 0.16
IGL02212:Drd3 APN 16 43762312 missense probably benign 0.21
IGL02666:Drd3 APN 16 43816956 splice site probably benign
R0529:Drd3 UTSW 16 43822714 missense probably damaging 1.00
R1102:Drd3 UTSW 16 43762483 missense probably damaging 1.00
R1310:Drd3 UTSW 16 43821529 missense probably damaging 0.96
R1548:Drd3 UTSW 16 43821341 missense probably benign 0.01
R3124:Drd3 UTSW 16 43822792 missense probably damaging 1.00
R3753:Drd3 UTSW 16 43817103 missense probably damaging 1.00
R4363:Drd3 UTSW 16 43762359 missense probably damaging 1.00
R4724:Drd3 UTSW 16 43822801 nonsense probably null
R4725:Drd3 UTSW 16 43822801 nonsense probably null
R4726:Drd3 UTSW 16 43822801 nonsense probably null
R5016:Drd3 UTSW 16 43762246 missense possibly damaging 0.88
R5850:Drd3 UTSW 16 43818332 missense probably benign 0.00
R6377:Drd3 UTSW 16 43821307 nonsense probably null
R6888:Drd3 UTSW 16 43817139 missense probably benign 0.22
R6928:Drd3 UTSW 16 43821320 missense probably benign 0.16
R7031:Drd3 UTSW 16 43762498 missense probably damaging 0.98
R7089:Drd3 UTSW 16 43807378 missense probably damaging 1.00
R7447:Drd3 UTSW 16 43817063 nonsense probably null
R7567:Drd3 UTSW 16 43822684 missense probably benign 0.00
R7575:Drd3 UTSW 16 43817133 missense probably benign 0.11
R7772:Drd3 UTSW 16 43762395 missense probably benign 0.05
R8694:Drd3 UTSW 16 43822712 missense probably damaging 1.00
R8962:Drd3 UTSW 16 43821479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCAATGATGGAATGTTC -3'
(R):5'- AACCTGCCATTGCTGAGTTTTC -3'

Sequencing Primer
(F):5'- AGCCTGTTTTCAGTTGTAAAGTCAG -3'
(R):5'- GAGTTTTCGAACCTCTAAGCTGAGC -3'
Posted On2017-07-14