Incidental Mutation 'R0519:Slc39a4'
ID48420
Institutional Source Beutler Lab
Gene Symbol Slc39a4
Ensembl Gene ENSMUSG00000063354
Gene Namesolute carrier family 39 (zinc transporter), member 4
SynonymsAWMS2, zip4, 1600025H15Rik
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0519 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76612383-76617384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76615138 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 192 (N192K)
Ref Sequence ENSEMBL: ENSMUSP00000155442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073428] [ENSMUST00000230977]
Predicted Effect probably benign
Transcript: ENSMUST00000073428
AA Change: N192K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073134
Gene: ENSMUSG00000063354
AA Change: N192K

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
Pfam:Zip 335 652 3.5e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230317
Predicted Effect probably benign
Transcript: ENSMUST00000230977
AA Change: N192K

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc/iron-regulated transporter-like protein (ZIP) family. The encoded protein localizes to cell membranes and is required for zinc uptake in the intestine. Mutations in this gene result in acrodermatitis enteropathica. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic letahlity around E10. Mice heterozygous for a null allele exhibit developmental defects similar to the teratology of zinc deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Slc39a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Slc39a4 APN 15 76614203 missense probably damaging 1.00
IGL02597:Slc39a4 APN 15 76613624 missense probably benign
IGL02798:Slc39a4 APN 15 76615182 missense probably benign 0.04
texline UTSW 15 76614083 missense probably damaging 1.00
R0815:Slc39a4 UTSW 15 76612639 missense probably damaging 1.00
R1502:Slc39a4 UTSW 15 76616593 missense probably benign 0.00
R1547:Slc39a4 UTSW 15 76614147 nonsense probably null
R2919:Slc39a4 UTSW 15 76616670 missense probably damaging 1.00
R4634:Slc39a4 UTSW 15 76614493 missense probably benign
R5029:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5030:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5669:Slc39a4 UTSW 15 76614163 missense probably damaging 1.00
R6020:Slc39a4 UTSW 15 76616142 missense probably benign 0.03
R6741:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R6920:Slc39a4 UTSW 15 76613270 missense probably damaging 0.99
R7072:Slc39a4 UTSW 15 76613258 missense probably damaging 1.00
RF035:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF040:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF041:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF042:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF043:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF044:Slc39a4 UTSW 15 76614870 small insertion probably benign
Z1176:Slc39a4 UTSW 15 76614173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGTCCCATACACTAGAGTTGCTG -3'
(R):5'- AGGTGGACTCCTGAAGCCAATACTG -3'

Sequencing Primer
(F):5'- caaaaaaacaaaaacaaaaacaGTGC -3'
(R):5'- CCAATACTGAGGGCAGAGTTG -3'
Posted On2013-06-12