Incidental Mutation 'R6052:Map3k11'
ID484200
Institutional Source Beutler Lab
Gene Symbol Map3k11
Ensembl Gene ENSMUSG00000004054
Gene Namemitogen-activated protein kinase kinase kinase 11
SynonymsMlk3, 2610017K16Rik
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5689131-5702862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5697402 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 555 (D555E)
Ref Sequence ENSEMBL: ENSMUSP00000004156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156]
Predicted Effect probably benign
Transcript: ENSMUST00000004156
AA Change: D555E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054
AA Change: D555E

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted or spontaneous mutation display a pattern of dark red stripes of thin dorsal epithelium during pre-wean development, and necrotic dental pulp has been reported for the spontaneous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Map3k11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Map3k11 APN 19 5697623 missense possibly damaging 0.91
IGL02581:Map3k11 APN 19 5700806 missense probably benign
R0130:Map3k11 UTSW 19 5690815 missense probably damaging 1.00
R0193:Map3k11 UTSW 19 5695846 missense probably damaging 0.99
R1621:Map3k11 UTSW 19 5690806 missense probably damaging 1.00
R1736:Map3k11 UTSW 19 5697401 missense probably benign 0.34
R1791:Map3k11 UTSW 19 5695572 nonsense probably null
R3500:Map3k11 UTSW 19 5690247 start codon destroyed probably benign 0.08
R3836:Map3k11 UTSW 19 5690803 missense possibly damaging 0.71
R3892:Map3k11 UTSW 19 5702283 missense probably benign 0.13
R4303:Map3k11 UTSW 19 5690824 missense probably damaging 1.00
R4513:Map3k11 UTSW 19 5702210 missense probably damaging 0.97
R4613:Map3k11 UTSW 19 5697470 missense probably benign 0.18
R4613:Map3k11 UTSW 19 5697471 missense probably damaging 0.98
R4631:Map3k11 UTSW 19 5690913 missense probably benign 0.30
R4780:Map3k11 UTSW 19 5690938 missense probably damaging 0.99
R5213:Map3k11 UTSW 19 5690641 missense probably damaging 0.99
R5266:Map3k11 UTSW 19 5700594 missense probably benign 0.03
R5372:Map3k11 UTSW 19 5690962 missense probably damaging 1.00
R5736:Map3k11 UTSW 19 5696711 missense probably damaging 1.00
R5899:Map3k11 UTSW 19 5695909 critical splice donor site probably null
R6388:Map3k11 UTSW 19 5690251 missense probably damaging 0.96
R6623:Map3k11 UTSW 19 5695603 missense probably damaging 0.97
R6975:Map3k11 UTSW 19 5690727 missense possibly damaging 0.91
R7309:Map3k11 UTSW 19 5690458 missense probably damaging 0.99
R7771:Map3k11 UTSW 19 5690608 missense probably damaging 0.99
R7815:Map3k11 UTSW 19 5695639 missense possibly damaging 0.89
X0025:Map3k11 UTSW 19 5696195 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGCCAATAAGTGACAGAGC -3'
(R):5'- GAATCTAGGTACCACGTGGC -3'

Sequencing Primer
(F):5'- GCACAAATTCAGACATTCTCATTGC -3'
(R):5'- AGGTACCACGTGGCTTCATC -3'
Posted On2017-07-14