Incidental Mutation 'R6052:Entpd1'
ID484202
Institutional Source Beutler Lab
Gene Symbol Entpd1
Ensembl Gene ENSMUSG00000048120
Gene Nameectonucleoside triphosphate diphosphohydrolase 1
Synonyms2610206B08Rik, Cd39, ectoapyrase, NTPDase-1
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40612366-40741602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40720484 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 58 (S58P)
Ref Sequence ENSEMBL: ENSMUSP00000116349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112231] [ENSMUST00000127828] [ENSMUST00000134063] [ENSMUST00000156598]
Predicted Effect probably damaging
Transcript: ENSMUST00000112231
AA Change: S58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107850
Gene: ENSMUSG00000048120
AA Change: S58P

DomainStartEndE-ValueType
Pfam:GDA1_CD39 40 471 7.8e-160 PFAM
transmembrane domain 477 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127828
SMART Domains Protein: ENSMUSP00000117213
Gene: ENSMUSG00000048120

DomainStartEndE-ValueType
Pfam:GDA1_CD39 1 63 1.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134063
AA Change: S87P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116285
Gene: ENSMUSG00000048120
AA Change: S87P

DomainStartEndE-ValueType
Pfam:GDA1_CD39 69 500 6.9e-170 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144080
Predicted Effect probably damaging
Transcript: ENSMUST00000156598
AA Change: S58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116349
Gene: ENSMUSG00000048120
AA Change: S58P

DomainStartEndE-ValueType
Pfam:GDA1_CD39 40 281 6.1e-101 PFAM
Meta Mutation Damage Score 0.7724 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane protein that hydrolyzes extracellular ATP and ADP to AMP. Inhibition of this protein's activity may confer anticancer benefits. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscle contraction, synaptic transmitter release and blood coagulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tecpr2 T C 12: 110,918,891 V168A possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Entpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Entpd1 APN 19 40711270 missense probably benign 0.21
IGL02624:Entpd1 APN 19 40726058 nonsense probably null
IGL02893:Entpd1 APN 19 40727517 missense probably damaging 0.99
R0413:Entpd1 UTSW 19 40711285 missense probably benign
R0626:Entpd1 UTSW 19 40727325 missense probably benign 0.36
R0666:Entpd1 UTSW 19 40659906 splice site probably benign
R1460:Entpd1 UTSW 19 40726188 missense probably damaging 1.00
R1518:Entpd1 UTSW 19 40725063 nonsense probably null
R1710:Entpd1 UTSW 19 40726236 missense probably benign 0.00
R1757:Entpd1 UTSW 19 40739006 missense probably benign 0.01
R1759:Entpd1 UTSW 19 40612524 critical splice donor site probably null
R2143:Entpd1 UTSW 19 40736783 missense probably damaging 1.00
R3876:Entpd1 UTSW 19 40736820 missense probably damaging 1.00
R4937:Entpd1 UTSW 19 40739521 unclassified probably benign
R5082:Entpd1 UTSW 19 40725029 splice site probably null
R5764:Entpd1 UTSW 19 40738973 splice site probably null
R5906:Entpd1 UTSW 19 40738839 missense probably damaging 1.00
R7154:Entpd1 UTSW 19 40724986 missense probably damaging 0.99
R7408:Entpd1 UTSW 19 40738865 missense possibly damaging 0.50
R7814:Entpd1 UTSW 19 40727447 missense probably damaging 1.00
R7976:Entpd1 UTSW 19 40612421 start codon destroyed probably null 0.00
R8438:Entpd1 UTSW 19 40736780 missense possibly damaging 0.67
W0251:Entpd1 UTSW 19 40726253 missense probably damaging 0.96
Z1176:Entpd1 UTSW 19 40738964 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGATAACCCTTGGCACTGGG -3'
(R):5'- GCCTGGCTCAGTGTCATTTTAC -3'

Sequencing Primer
(F):5'- GCTCTAGTTCTCAGCACCAAATG -3'
(R):5'- CAGTGATAATAAAATACCAACGGCAG -3'
Posted On2017-07-14