Incidental Mutation 'R6053:Olfr414'
ID484210
Institutional Source Beutler Lab
Gene Symbol Olfr414
Ensembl Gene ENSMUSG00000051509
Gene Nameolfactory receptor 414
SynonymsGA_x6K02T2P20D-20749615-20748662, MOR103-10
MMRRC Submission 044221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6053 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174424064-174434747 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 174430569 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 47 (S47*)
Ref Sequence ENSEMBL: ENSMUSP00000142051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053178] [ENSMUST00000192358]
Predicted Effect probably null
Transcript: ENSMUST00000053178
AA Change: S47*
SMART Domains Protein: ENSMUSP00000052426
Gene: ENSMUSG00000051509
AA Change: S47*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-53 PFAM
Pfam:7tm_1 41 290 8.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192358
AA Change: S47*
SMART Domains Protein: ENSMUSP00000142051
Gene: ENSMUSG00000051509
AA Change: S47*

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.9e-29 PFAM
Pfam:7tm_4 139 283 1.1e-45 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,461 D785G probably benign Het
Abca4 T C 3: 122,171,017 Y2158H probably damaging Het
Acap1 T G 11: 69,887,070 probably null Het
Adamts4 T A 1: 171,252,715 I279N possibly damaging Het
Akap3 A G 6: 126,866,533 E705G probably damaging Het
Arap3 C A 18: 37,990,771 L398F probably damaging Het
BC067074 C A 13: 113,320,726 P1102Q possibly damaging Het
Catsperg1 A T 7: 29,210,814 L34* probably null Het
Ccdc171 T G 4: 83,795,219 L1165R probably damaging Het
Ccdc3 G A 2: 5,229,027 V221I probably benign Het
Cdc42ep4 T A 11: 113,728,986 H193L probably damaging Het
Clcn1 G A 6: 42,300,274 W361* probably null Het
Cntn2 T C 1: 132,518,352 N832S probably benign Het
Col5a1 A T 2: 28,014,377 probably benign Het
Ctc1 T A 11: 69,027,901 M550K probably benign Het
Dennd5a T C 7: 109,933,745 R273G probably damaging Het
Dnajb7 T C 15: 81,407,299 E279G probably benign Het
Dopey1 G T 9: 86,515,294 G882W possibly damaging Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Ect2l A T 10: 18,141,844 L629Q probably damaging Het
Enpp1 T C 10: 24,657,126 D497G possibly damaging Het
Ep400 T C 5: 110,755,795 M313V probably benign Het
Epn2 T C 11: 61,546,497 Y83C probably damaging Het
Ercc3 T G 18: 32,246,754 V338G probably damaging Het
Fkbp5 T C 17: 28,428,466 I132V probably benign Het
Fn1 A T 1: 71,599,290 Y1846N probably damaging Het
Foxg1 T C 12: 49,385,378 L298P possibly damaging Het
Foxo3 G A 10: 42,197,214 P436S probably benign Het
Gbx2 T C 1: 89,930,437 T107A probably benign Het
Gli1 G T 10: 127,334,315 H324N probably damaging Het
Gnas T A 2: 174,299,852 S605T possibly damaging Het
Ica1 C T 6: 8,630,783 A431T probably benign Het
Il10ra C T 9: 45,256,303 D319N probably damaging Het
Jmjd4 T A 11: 59,454,044 H274Q probably damaging Het
Krt28 C A 11: 99,371,201 L294F probably benign Het
Ltbp3 C A 19: 5,752,094 T766K probably damaging Het
Man2b2 C A 5: 36,813,038 M841I probably benign Het
Mmp14 T A 14: 54,435,890 M85K probably benign Het
Mmp1b T A 9: 7,385,031 D206V probably benign Het
Muc5b T C 7: 141,864,708 F3797S probably benign Het
Mug1 A G 6: 121,865,738 D561G probably benign Het
Myo18a T A 11: 77,818,176 H471Q probably damaging Het
Nfkb2 A G 19: 46,311,812 E873G probably damaging Het
Ngfr G A 11: 95,571,006 H361Y possibly damaging Het
Nnt T C 13: 119,357,509 T679A possibly damaging Het
Notch1 A T 2: 26,472,912 N947K probably benign Het
Nrg4 A T 9: 55,236,490 V94D probably benign Het
Nsd1 G T 13: 55,293,609 C1631F probably damaging Het
Nutm1 T C 2: 112,249,090 T827A probably benign Het
Olfr1219 T C 2: 89,074,554 D179G probably damaging Het
Olfr187 A T 16: 59,035,988 Y250N probably damaging Het
Olfr328 T A 11: 58,552,066 M58L possibly damaging Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Orai3 C T 7: 127,773,878 P184S probably benign Het
Paqr3 A T 5: 97,111,278 S56T probably benign Het
Pard6b C T 2: 168,099,053 T320M possibly damaging Het
Pgs1 T C 11: 118,001,709 S166P probably damaging Het
Plaa T C 4: 94,589,884 T114A probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plin4 A T 17: 56,108,618 D73E probably benign Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Rbak A C 5: 143,174,682 Y205* probably null Het
Rgs12 T C 5: 34,965,952 F360L probably benign Het
Rgs22 A T 15: 36,100,007 D187E probably benign Het
Sec24d C T 3: 123,279,222 Q66* probably null Het
Sh2d5 T A 4: 138,255,562 M85K probably damaging Het
Sos1 A G 17: 80,415,034 V861A possibly damaging Het
Stk11ip T A 1: 75,534,255 probably null Het
Svs1 A G 6: 48,988,488 T477A probably benign Het
Tmem26 G A 10: 68,748,484 E127K probably benign Het
Tmem41a T G 16: 21,934,989 T211P possibly damaging Het
Tmem69 T A 4: 116,553,384 M130L possibly damaging Het
Trak2 C A 1: 58,904,069 R726L possibly damaging Het
Vmn1r231 A G 17: 20,889,819 I278T probably damaging Het
Vwf G A 6: 125,600,665 V490I probably benign Het
Wdr33 C T 18: 31,878,063 T255I possibly damaging Het
Ylpm1 G T 12: 84,996,503 W5L possibly damaging Het
Zfp169 A T 13: 48,498,858 W28R probably damaging Het
Other mutations in Olfr414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Olfr414 APN 1 174431342 missense probably benign 0.00
IGL01560:Olfr414 APN 1 174430901 missense probably benign 0.17
IGL01795:Olfr414 APN 1 174430649 missense possibly damaging 0.83
IGL03286:Olfr414 APN 1 174431177 missense probably benign 0.01
PIT4131001:Olfr414 UTSW 1 174430824 missense probably damaging 1.00
R0219:Olfr414 UTSW 1 174430466 missense probably benign 0.00
R0492:Olfr414 UTSW 1 174430563 missense possibly damaging 0.95
R1052:Olfr414 UTSW 1 174431135 nonsense probably null
R1054:Olfr414 UTSW 1 174430853 missense probably benign 0.36
R1473:Olfr414 UTSW 1 174430643 missense probably damaging 0.97
R1675:Olfr414 UTSW 1 174431097 missense probably benign
R1774:Olfr414 UTSW 1 174431339 missense probably benign 0.00
R1861:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R1959:Olfr414 UTSW 1 174430905 missense probably damaging 1.00
R1978:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R4043:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R5020:Olfr414 UTSW 1 174430671 missense probably damaging 0.98
R5354:Olfr414 UTSW 1 174430686 missense probably damaging 0.98
R5873:Olfr414 UTSW 1 174430782 missense possibly damaging 0.84
Z1176:Olfr414 UTSW 1 174430591 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CGATGCACCTGCCTTTTAGC -3'
(R):5'- ACACTCAGTGCAGGCTAAGG -3'

Sequencing Primer
(F):5'- TTATTCCTGTTACTTTTGCAGGC -3'
(R):5'- CTCAGTGCAGGCTAAGGCAATAAAG -3'
Posted On2017-07-14