Incidental Mutation 'R6053:Sec24d'
ID 484219
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
MMRRC Submission 044221-MU
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6053 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 123279222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 66 (Q66*)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923] [ENSMUST00000200333]
AlphaFold Q6NXL1
Predicted Effect probably null
Transcript: ENSMUST00000047923
AA Change: Q66*
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: Q66*

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198210
Predicted Effect probably benign
Transcript: ENSMUST00000200333
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,461 D785G probably benign Het
Abca4 T C 3: 122,171,017 Y2158H probably damaging Het
Acap1 T G 11: 69,887,070 probably null Het
Adamts4 T A 1: 171,252,715 I279N possibly damaging Het
Akap3 A G 6: 126,866,533 E705G probably damaging Het
Arap3 C A 18: 37,990,771 L398F probably damaging Het
BC067074 C A 13: 113,320,726 P1102Q possibly damaging Het
Catsperg1 A T 7: 29,210,814 L34* probably null Het
Ccdc171 T G 4: 83,795,219 L1165R probably damaging Het
Ccdc3 G A 2: 5,229,027 V221I probably benign Het
Cdc42ep4 T A 11: 113,728,986 H193L probably damaging Het
Clcn1 G A 6: 42,300,274 W361* probably null Het
Cntn2 T C 1: 132,518,352 N832S probably benign Het
Col5a1 A T 2: 28,014,377 probably benign Het
Ctc1 T A 11: 69,027,901 M550K probably benign Het
Dennd5a T C 7: 109,933,745 R273G probably damaging Het
Dnajb7 T C 15: 81,407,299 E279G probably benign Het
Dopey1 G T 9: 86,515,294 G882W possibly damaging Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Ect2l A T 10: 18,141,844 L629Q probably damaging Het
Enpp1 T C 10: 24,657,126 D497G possibly damaging Het
Ep400 T C 5: 110,755,795 M313V probably benign Het
Epn2 T C 11: 61,546,497 Y83C probably damaging Het
Ercc3 T G 18: 32,246,754 V338G probably damaging Het
Fkbp5 T C 17: 28,428,466 I132V probably benign Het
Fn1 A T 1: 71,599,290 Y1846N probably damaging Het
Foxg1 T C 12: 49,385,378 L298P possibly damaging Het
Foxo3 G A 10: 42,197,214 P436S probably benign Het
Gbx2 T C 1: 89,930,437 T107A probably benign Het
Gli1 G T 10: 127,334,315 H324N probably damaging Het
Gnas T A 2: 174,299,852 S605T possibly damaging Het
Ica1 C T 6: 8,630,783 A431T probably benign Het
Il10ra C T 9: 45,256,303 D319N probably damaging Het
Jmjd4 T A 11: 59,454,044 H274Q probably damaging Het
Krt28 C A 11: 99,371,201 L294F probably benign Het
Ltbp3 C A 19: 5,752,094 T766K probably damaging Het
Man2b2 C A 5: 36,813,038 M841I probably benign Het
Mmp14 T A 14: 54,435,890 M85K probably benign Het
Mmp1b T A 9: 7,385,031 D206V probably benign Het
Muc5b T C 7: 141,864,708 F3797S probably benign Het
Mug1 A G 6: 121,865,738 D561G probably benign Het
Myo18a T A 11: 77,818,176 H471Q probably damaging Het
Nfkb2 A G 19: 46,311,812 E873G probably damaging Het
Ngfr G A 11: 95,571,006 H361Y possibly damaging Het
Nnt T C 13: 119,357,509 T679A possibly damaging Het
Notch1 A T 2: 26,472,912 N947K probably benign Het
Nrg4 A T 9: 55,236,490 V94D probably benign Het
Nsd1 G T 13: 55,293,609 C1631F probably damaging Het
Nutm1 T C 2: 112,249,090 T827A probably benign Het
Olfr1219 T C 2: 89,074,554 D179G probably damaging Het
Olfr187 A T 16: 59,035,988 Y250N probably damaging Het
Olfr328 T A 11: 58,552,066 M58L possibly damaging Het
Olfr414 C A 1: 174,430,569 S47* probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Orai3 C T 7: 127,773,878 P184S probably benign Het
Paqr3 A T 5: 97,111,278 S56T probably benign Het
Pard6b C T 2: 168,099,053 T320M possibly damaging Het
Pgs1 T C 11: 118,001,709 S166P probably damaging Het
Plaa T C 4: 94,589,884 T114A probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plin4 A T 17: 56,108,618 D73E probably benign Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Rbak A C 5: 143,174,682 Y205* probably null Het
Rgs12 T C 5: 34,965,952 F360L probably benign Het
Rgs22 A T 15: 36,100,007 D187E probably benign Het
Sh2d5 T A 4: 138,255,562 M85K probably damaging Het
Sos1 A G 17: 80,415,034 V861A possibly damaging Het
Stk11ip T A 1: 75,534,255 probably null Het
Svs1 A G 6: 48,988,488 T477A probably benign Het
Tmem26 G A 10: 68,748,484 E127K probably benign Het
Tmem41a T G 16: 21,934,989 T211P possibly damaging Het
Tmem69 T A 4: 116,553,384 M130L possibly damaging Het
Trak2 C A 1: 58,904,069 R726L possibly damaging Het
Vmn1r231 A G 17: 20,889,819 I278T probably damaging Het
Vwf G A 6: 125,600,665 V490I probably benign Het
Wdr33 C T 18: 31,878,063 T255I possibly damaging Het
Ylpm1 G T 12: 84,996,503 W5L possibly damaging Het
Zfp169 A T 13: 48,498,858 W28R probably damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAAGAACCTTGTGTTTACCC -3'
(R):5'- AGGGTAGTTCTCCAGTAAACATG -3'

Sequencing Primer
(F):5'- GAGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- AAGGGTCCTTTGGAAGAG -3'
Posted On 2017-07-14