Incidental Mutation 'R6053:Vwf'
ID484233
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene NameVon Willebrand factor
Synonyms6820430P06Rik, B130011O06Rik
MMRRC Submission 044221-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R6053 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125546774-125686679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125600665 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 490 (V490I)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
Predicted Effect probably benign
Transcript: ENSMUST00000112254
AA Change: V490I

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: V490I

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,461 D785G probably benign Het
Abca4 T C 3: 122,171,017 Y2158H probably damaging Het
Acap1 T G 11: 69,887,070 probably null Het
Adamts4 T A 1: 171,252,715 I279N possibly damaging Het
Akap3 A G 6: 126,866,533 E705G probably damaging Het
Arap3 C A 18: 37,990,771 L398F probably damaging Het
BC067074 C A 13: 113,320,726 P1102Q possibly damaging Het
Catsperg1 A T 7: 29,210,814 L34* probably null Het
Ccdc171 T G 4: 83,795,219 L1165R probably damaging Het
Ccdc3 G A 2: 5,229,027 V221I probably benign Het
Cdc42ep4 T A 11: 113,728,986 H193L probably damaging Het
Clcn1 G A 6: 42,300,274 W361* probably null Het
Cntn2 T C 1: 132,518,352 N832S probably benign Het
Col5a1 A T 2: 28,014,377 probably benign Het
Ctc1 T A 11: 69,027,901 M550K probably benign Het
Dennd5a T C 7: 109,933,745 R273G probably damaging Het
Dnajb7 T C 15: 81,407,299 E279G probably benign Het
Dopey1 G T 9: 86,515,294 G882W possibly damaging Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Ect2l A T 10: 18,141,844 L629Q probably damaging Het
Enpp1 T C 10: 24,657,126 D497G possibly damaging Het
Ep400 T C 5: 110,755,795 M313V probably benign Het
Epn2 T C 11: 61,546,497 Y83C probably damaging Het
Ercc3 T G 18: 32,246,754 V338G probably damaging Het
Fkbp5 T C 17: 28,428,466 I132V probably benign Het
Fn1 A T 1: 71,599,290 Y1846N probably damaging Het
Foxg1 T C 12: 49,385,378 L298P possibly damaging Het
Foxo3 G A 10: 42,197,214 P436S probably benign Het
Gbx2 T C 1: 89,930,437 T107A probably benign Het
Gli1 G T 10: 127,334,315 H324N probably damaging Het
Gnas T A 2: 174,299,852 S605T possibly damaging Het
Ica1 C T 6: 8,630,783 A431T probably benign Het
Il10ra C T 9: 45,256,303 D319N probably damaging Het
Jmjd4 T A 11: 59,454,044 H274Q probably damaging Het
Krt28 C A 11: 99,371,201 L294F probably benign Het
Ltbp3 C A 19: 5,752,094 T766K probably damaging Het
Man2b2 C A 5: 36,813,038 M841I probably benign Het
Mmp14 T A 14: 54,435,890 M85K probably benign Het
Mmp1b T A 9: 7,385,031 D206V probably benign Het
Muc5b T C 7: 141,864,708 F3797S probably benign Het
Mug1 A G 6: 121,865,738 D561G probably benign Het
Myo18a T A 11: 77,818,176 H471Q probably damaging Het
Nfkb2 A G 19: 46,311,812 E873G probably damaging Het
Ngfr G A 11: 95,571,006 H361Y possibly damaging Het
Nnt T C 13: 119,357,509 T679A possibly damaging Het
Notch1 A T 2: 26,472,912 N947K probably benign Het
Nrg4 A T 9: 55,236,490 V94D probably benign Het
Nsd1 G T 13: 55,293,609 C1631F probably damaging Het
Nutm1 T C 2: 112,249,090 T827A probably benign Het
Olfr1219 T C 2: 89,074,554 D179G probably damaging Het
Olfr187 A T 16: 59,035,988 Y250N probably damaging Het
Olfr328 T A 11: 58,552,066 M58L possibly damaging Het
Olfr414 C A 1: 174,430,569 S47* probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Orai3 C T 7: 127,773,878 P184S probably benign Het
Paqr3 A T 5: 97,111,278 S56T probably benign Het
Pard6b C T 2: 168,099,053 T320M possibly damaging Het
Pgs1 T C 11: 118,001,709 S166P probably damaging Het
Plaa T C 4: 94,589,884 T114A probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plin4 A T 17: 56,108,618 D73E probably benign Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Rbak A C 5: 143,174,682 Y205* probably null Het
Rgs12 T C 5: 34,965,952 F360L probably benign Het
Rgs22 A T 15: 36,100,007 D187E probably benign Het
Sec24d C T 3: 123,279,222 Q66* probably null Het
Sh2d5 T A 4: 138,255,562 M85K probably damaging Het
Sos1 A G 17: 80,415,034 V861A possibly damaging Het
Stk11ip T A 1: 75,534,255 probably null Het
Svs1 A G 6: 48,988,488 T477A probably benign Het
Tmem26 G A 10: 68,748,484 E127K probably benign Het
Tmem41a T G 16: 21,934,989 T211P possibly damaging Het
Tmem69 T A 4: 116,553,384 M130L possibly damaging Het
Trak2 C A 1: 58,904,069 R726L possibly damaging Het
Vmn1r231 A G 17: 20,889,819 I278T probably damaging Het
Wdr33 C T 18: 31,878,063 T255I possibly damaging Het
Ylpm1 G T 12: 84,996,503 W5L possibly damaging Het
Zfp169 A T 13: 48,498,858 W28R probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCAGAGAGGTCTCCCTTACAC -3'
(R):5'- ACAGAGAGGCCTGTTCCTTG -3'

Sequencing Primer
(F):5'- ACTCATGGACATTTATTTGATCTCC -3'
(R):5'- AGAGGCCTGTTCCTTGCTCTG -3'
Posted On2017-07-14