Incidental Mutation 'R0519:Asxl3'
ID48426
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R0519 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22523520 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1529 (Q1529R)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097655
AA Change: Q1529R

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: Q1529R

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120223
AA Change: Q1529R

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: Q1529R

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Meta Mutation Damage Score 0.0858 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
BB001:Asxl3 UTSW 18 22525545 missense probably damaging 0.98
BB011:Asxl3 UTSW 18 22525545 missense probably damaging 0.98
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0520:Asxl3 UTSW 18 22522986 missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R2907:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22524233 missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22523115 missense probably benign 0.45
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R5873:Asxl3 UTSW 18 22516085 missense probably benign 0.04
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7058:Asxl3 UTSW 18 22517674 missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22411499 critical splice acceptor site probably null
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
R7431:Asxl3 UTSW 18 22516953 missense probably damaging 1.00
R7851:Asxl3 UTSW 18 22517222 missense possibly damaging 0.62
R7871:Asxl3 UTSW 18 22524224 missense not run
R7880:Asxl3 UTSW 18 22522151 missense possibly damaging 0.90
R7924:Asxl3 UTSW 18 22525545 missense probably damaging 0.98
R8061:Asxl3 UTSW 18 22524243 missense possibly damaging 0.62
R8115:Asxl3 UTSW 18 22517585 missense probably damaging 0.99
R8174:Asxl3 UTSW 18 22517743 missense probably benign 0.02
R8303:Asxl3 UTSW 18 22524416 missense probably benign
R8360:Asxl3 UTSW 18 22516117 missense probably benign
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Z1176:Asxl3 UTSW 18 22522220 missense probably damaging 1.00
Z1177:Asxl3 UTSW 18 22516339 missense probably benign 0.00
Z1177:Asxl3 UTSW 18 22523591 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACGCTGACCTCCAATTTGTCTC -3'
(R):5'- TGCATAGCTGACATGCTCTGTCTTC -3'

Sequencing Primer
(F):5'- GTCTGTCATCAGTAGACCTGAGC -3'
(R):5'- TTCACAGCCTTCAGGCCAG -3'
Posted On2013-06-12