Incidental Mutation 'R6053:Nsd1'
ID484264
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
MMRRC Submission 044221-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6053 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55293609 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1631 (C1631F)
Ref Sequence ENSEMBL: ENSMUSP00000153677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
Predicted Effect probably damaging
Transcript: ENSMUST00000099490
AA Change: C1734F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: C1734F

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224973
AA Change: C1631F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225405
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,461 D785G probably benign Het
Abca4 T C 3: 122,171,017 Y2158H probably damaging Het
Acap1 T G 11: 69,887,070 probably null Het
Adamts4 T A 1: 171,252,715 I279N possibly damaging Het
Akap3 A G 6: 126,866,533 E705G probably damaging Het
Arap3 C A 18: 37,990,771 L398F probably damaging Het
BC067074 C A 13: 113,320,726 P1102Q possibly damaging Het
Catsperg1 A T 7: 29,210,814 L34* probably null Het
Ccdc171 T G 4: 83,795,219 L1165R probably damaging Het
Ccdc3 G A 2: 5,229,027 V221I probably benign Het
Cdc42ep4 T A 11: 113,728,986 H193L probably damaging Het
Clcn1 G A 6: 42,300,274 W361* probably null Het
Cntn2 T C 1: 132,518,352 N832S probably benign Het
Col5a1 A T 2: 28,014,377 probably benign Het
Ctc1 T A 11: 69,027,901 M550K probably benign Het
Dennd5a T C 7: 109,933,745 R273G probably damaging Het
Dnajb7 T C 15: 81,407,299 E279G probably benign Het
Dopey1 G T 9: 86,515,294 G882W possibly damaging Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Ect2l A T 10: 18,141,844 L629Q probably damaging Het
Enpp1 T C 10: 24,657,126 D497G possibly damaging Het
Ep400 T C 5: 110,755,795 M313V probably benign Het
Epn2 T C 11: 61,546,497 Y83C probably damaging Het
Ercc3 T G 18: 32,246,754 V338G probably damaging Het
Fkbp5 T C 17: 28,428,466 I132V probably benign Het
Fn1 A T 1: 71,599,290 Y1846N probably damaging Het
Foxg1 T C 12: 49,385,378 L298P possibly damaging Het
Foxo3 G A 10: 42,197,214 P436S probably benign Het
Gbx2 T C 1: 89,930,437 T107A probably benign Het
Gli1 G T 10: 127,334,315 H324N probably damaging Het
Gnas T A 2: 174,299,852 S605T possibly damaging Het
Ica1 C T 6: 8,630,783 A431T probably benign Het
Il10ra C T 9: 45,256,303 D319N probably damaging Het
Jmjd4 T A 11: 59,454,044 H274Q probably damaging Het
Krt28 C A 11: 99,371,201 L294F probably benign Het
Ltbp3 C A 19: 5,752,094 T766K probably damaging Het
Man2b2 C A 5: 36,813,038 M841I probably benign Het
Mmp14 T A 14: 54,435,890 M85K probably benign Het
Mmp1b T A 9: 7,385,031 D206V probably benign Het
Muc5b T C 7: 141,864,708 F3797S probably benign Het
Mug1 A G 6: 121,865,738 D561G probably benign Het
Myo18a T A 11: 77,818,176 H471Q probably damaging Het
Nfkb2 A G 19: 46,311,812 E873G probably damaging Het
Ngfr G A 11: 95,571,006 H361Y possibly damaging Het
Nnt T C 13: 119,357,509 T679A possibly damaging Het
Notch1 A T 2: 26,472,912 N947K probably benign Het
Nrg4 A T 9: 55,236,490 V94D probably benign Het
Nutm1 T C 2: 112,249,090 T827A probably benign Het
Olfr1219 T C 2: 89,074,554 D179G probably damaging Het
Olfr187 A T 16: 59,035,988 Y250N probably damaging Het
Olfr328 T A 11: 58,552,066 M58L possibly damaging Het
Olfr414 C A 1: 174,430,569 S47* probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Orai3 C T 7: 127,773,878 P184S probably benign Het
Paqr3 A T 5: 97,111,278 S56T probably benign Het
Pard6b C T 2: 168,099,053 T320M possibly damaging Het
Pgs1 T C 11: 118,001,709 S166P probably damaging Het
Plaa T C 4: 94,589,884 T114A probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plin4 A T 17: 56,108,618 D73E probably benign Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Rbak A C 5: 143,174,682 Y205* probably null Het
Rgs12 T C 5: 34,965,952 F360L probably benign Het
Rgs22 A T 15: 36,100,007 D187E probably benign Het
Sec24d C T 3: 123,279,222 Q66* probably null Het
Sh2d5 T A 4: 138,255,562 M85K probably damaging Het
Sos1 A G 17: 80,415,034 V861A possibly damaging Het
Stk11ip T A 1: 75,534,255 probably null Het
Svs1 A G 6: 48,988,488 T477A probably benign Het
Tmem26 G A 10: 68,748,484 E127K probably benign Het
Tmem41a T G 16: 21,934,989 T211P possibly damaging Het
Tmem69 T A 4: 116,553,384 M130L possibly damaging Het
Trak2 C A 1: 58,904,069 R726L possibly damaging Het
Vmn1r231 A G 17: 20,889,819 I278T probably damaging Het
Vwf G A 6: 125,600,665 V490I probably benign Het
Wdr33 C T 18: 31,878,063 T255I possibly damaging Het
Ylpm1 G T 12: 84,996,503 W5L possibly damaging Het
Zfp169 A T 13: 48,498,858 W28R probably damaging Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
Amanuensis UTSW 13 55261626 nonsense probably null
scribe UTSW 13 55291236 missense probably damaging 1.00
stenographer UTSW 13 55298376 splice site probably null
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7205:Nsd1 UTSW 13 55246470 missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
R7337:Nsd1 UTSW 13 55246209 missense probably damaging 1.00
R7432:Nsd1 UTSW 13 55213374 missense probably benign
R7638:Nsd1 UTSW 13 55312328 missense probably benign 0.01
R7647:Nsd1 UTSW 13 55299835 missense probably damaging 0.96
R7658:Nsd1 UTSW 13 55277639 missense probably damaging 1.00
R7884:Nsd1 UTSW 13 55313255 missense probably damaging 0.99
R8032:Nsd1 UTSW 13 55310383 missense probably damaging 1.00
R8113:Nsd1 UTSW 13 55245621 missense probably benign
R8152:Nsd1 UTSW 13 55310367 missense possibly damaging 0.49
R8183:Nsd1 UTSW 13 55312373 missense probably damaging 1.00
R8432:Nsd1 UTSW 13 55247703 missense possibly damaging 0.91
R8462:Nsd1 UTSW 13 55298376 splice site probably null
R8469:Nsd1 UTSW 13 55277553 missense possibly damaging 0.76
R8756:Nsd1 UTSW 13 55313693 missense probably benign 0.00
R8867:Nsd1 UTSW 13 55282757 missense probably damaging 1.00
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Z1176:Nsd1 UTSW 13 55245525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAAAGTCCTTCTGCACG -3'
(R):5'- GGGGATTACTATGCCGAAACATG -3'

Sequencing Primer
(F):5'- TGCACGTTTTACTATGTAAGCC -3'
(R):5'- TTACTATGCCGAAACATGAAGAGC -3'
Posted On2017-07-14