Incidental Mutation 'R6054:Dhx35'
Institutional Source Beutler Lab
Gene Symbol Dhx35
Ensembl Gene ENSMUSG00000027655
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 35
Synonyms1200009D07Rik, Ddx35
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6054 (G1)
Quality Score219.009
Status Not validated
Chromosomal Location158794807-158858214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158818299 bp
Amino Acid Change Tyrosine to Asparagine at position 184 (Y184N)
Ref Sequence ENSEMBL: ENSMUSP00000105104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]
Predicted Effect probably benign
Transcript: ENSMUST00000029186
AA Change: Y184N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: Y184N

DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Pfam:OB_NTP_bind 628 660 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109478
AA Change: Y184N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: Y184N

DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148359
Predicted Effect probably benign
Transcript: ENSMUST00000156893
SMART Domains Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655

PDB:3LLM|B 7 115 1e-10 PDB
Blast:DEXDc 55 119 5e-37 BLAST
SCOP:d1jpna2 63 115 3e-10 SMART
PDB:3KX2|A 116 204 1e-10 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Dhx35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dhx35 APN 2 158827916 missense probably damaging 1.00
IGL01942:Dhx35 APN 2 158831864 missense probably damaging 1.00
IGL02899:Dhx35 APN 2 158801450 missense probably damaging 1.00
IGL02927:Dhx35 APN 2 158820416 missense probably damaging 1.00
IGL03224:Dhx35 APN 2 158857132 utr 3 prime probably benign
R0112:Dhx35 UTSW 2 158840620 missense probably damaging 0.99
R0200:Dhx35 UTSW 2 158829623 missense probably benign
R0609:Dhx35 UTSW 2 158817415 missense possibly damaging 0.62
R0714:Dhx35 UTSW 2 158844183 missense probably benign
R0884:Dhx35 UTSW 2 158831711 missense probably damaging 0.97
R1775:Dhx35 UTSW 2 158806437 missense probably damaging 1.00
R1912:Dhx35 UTSW 2 158842307 missense probably damaging 0.96
R2136:Dhx35 UTSW 2 158831861 missense probably damaging 1.00
R4094:Dhx35 UTSW 2 158842356 missense probably damaging 1.00
R4364:Dhx35 UTSW 2 158842352 nonsense probably null
R4421:Dhx35 UTSW 2 158806401 missense probably damaging 1.00
R4565:Dhx35 UTSW 2 158849535 missense probably benign 0.01
R5517:Dhx35 UTSW 2 158834912 missense probably damaging 1.00
R5732:Dhx35 UTSW 2 158831785 missense probably damaging 0.99
R5979:Dhx35 UTSW 2 158842869 missense probably benign 0.29
R6405:Dhx35 UTSW 2 158794919 missense probably damaging 1.00
R6452:Dhx35 UTSW 2 158831687 missense probably damaging 1.00
R6519:Dhx35 UTSW 2 158831710 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-07-14