Incidental Mutation 'R6054:Leng8'
ID484299
Institutional Source Beutler Lab
Gene Symbol Leng8
Ensembl Gene ENSMUSG00000035545
Gene Nameleukocyte receptor cluster (LRC) member 8
Synonyms
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6054 (G1)
Quality Score213.009
Status Not validated
Chromosome7
Chromosomal Location4137039-4148177 bp(+) (GRCm38)
Type of Mutationunclassified (2392 bp from exon)
DNA Base Change (assembly) C to A at 4145523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037472] [ENSMUST00000058358] [ENSMUST00000121270] [ENSMUST00000128756] [ENSMUST00000144248] [ENSMUST00000154571]
Predicted Effect probably benign
Transcript: ENSMUST00000037472
AA Change: P765T

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545
AA Change: P765T

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000058358
SMART Domains Protein: ENSMUSP00000061079
Gene: ENSMUSG00000043432

DomainStartEndE-ValueType
ZnF_C3H1 8 34 1.72e-4 SMART
Pfam:DUF504 77 128 1.9e-11 PFAM
Pfam:AKAP7_NLS 305 484 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121270
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127723
Predicted Effect probably benign
Transcript: ENSMUST00000128756
SMART Domains Protein: ENSMUSP00000118832
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144248
SMART Domains Protein: ENSMUSP00000120574
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 346 359 N/A INTRINSIC
low complexity region 376 410 N/A INTRINSIC
low complexity region 416 431 N/A INTRINSIC
Pfam:SAC3_GANP 530 725 1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146434
Predicted Effect probably benign
Transcript: ENSMUST00000154571
SMART Domains Protein: ENSMUSP00000123328
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155881
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Leng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Leng8 APN 7 4145482 missense probably benign 0.03
IGL02437:Leng8 APN 7 4142093 missense probably damaging 0.99
R0104:Leng8 UTSW 7 4143808 missense probably damaging 0.99
R0774:Leng8 UTSW 7 4142136 missense probably damaging 1.00
R1696:Leng8 UTSW 7 4145136 missense probably damaging 1.00
R2001:Leng8 UTSW 7 4145074 missense probably damaging 1.00
R2012:Leng8 UTSW 7 4143610 missense probably damaging 1.00
R2054:Leng8 UTSW 7 4144290 nonsense probably null
R3433:Leng8 UTSW 7 4142132 missense probably benign 0.22
R4335:Leng8 UTSW 7 4147038 missense probably damaging 0.99
R4607:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4608:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4886:Leng8 UTSW 7 4144931 unclassified probably null
R5307:Leng8 UTSW 7 4145473 missense probably damaging 1.00
R5339:Leng8 UTSW 7 4145286 missense possibly damaging 0.96
R5368:Leng8 UTSW 7 4139988 missense probably damaging 0.97
R5370:Leng8 UTSW 7 4145434 missense possibly damaging 0.48
R5615:Leng8 UTSW 7 4144958 nonsense probably null
R5645:Leng8 UTSW 7 4145274 missense probably damaging 1.00
R5750:Leng8 UTSW 7 4142120 missense probably benign 0.04
R6041:Leng8 UTSW 7 4145569 missense probably benign 0.01
R6481:Leng8 UTSW 7 4145413 missense probably damaging 1.00
R6826:Leng8 UTSW 7 4145320 missense probably damaging 1.00
R6919:Leng8 UTSW 7 4143626 missense possibly damaging 0.82
R7313:Leng8 UTSW 7 4139526 missense possibly damaging 0.73
R7357:Leng8 UTSW 7 4144933 nonsense probably null
R7428:Leng8 UTSW 7 4143573 missense probably damaging 1.00
R7686:Leng8 UTSW 7 4143505 nonsense probably null
R8027:Leng8 UTSW 7 4142856 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACGGAACTGGCATACCTCAC -3'
(R):5'- GCAGGTTCCAAACTGATGTGAAC -3'

Sequencing Primer
(F):5'- GATGAAGGCAGACCCCTG -3'
(R):5'- TTCCAAACTGATGTGAACAGAAAG -3'
Posted On2017-07-14