Mutagenetix > Incidental Mutation

Incidental Mutation 'R6054:Trpm1'

484301

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

044222-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6054 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64268702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 597 (S597G)

Ref Sequence

ENSEMBL: ENSMUSP00000145593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: S1481G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: S1481G

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: S1365G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: S1487G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314
AA Change: S597G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,835,865	S93P	unknown	Het
Adam28	T	A	14: 68,642,152	N149I	probably benign	Het
Adam4	A	C	12: 81,420,054	F598V	probably damaging	Het
Adh5	A	G	3: 138,445,375	H33R	possibly damaging	Het
Apoh	A	G	11: 108,395,975	N75S	probably damaging	Het
Arrdc5	T	C	17: 56,294,420	E235G	possibly damaging	Het
Atm	T	C	9: 53,459,873	D2225G	probably damaging	Het
Atp6v0a1	C	T	11: 101,039,889	P514L	possibly damaging	Het
Brd9	T	A	13: 73,940,741	M195K	probably damaging	Het
Cacna1a	T	G	8: 84,556,785	S755A	probably damaging	Het
Ccdc85c	T	A	12: 108,274,769	H122L	unknown	Het
Ccs	A	T	19: 4,825,865	D192E	probably benign	Het
Cd3e	G	A	9: 45,002,161	T92M	possibly damaging	Het
Celsr2	A	G	3: 108,406,963	F1249L	possibly damaging	Het
Col16a1	G	A	4: 130,061,722		probably benign	Het
Col17a1	A	G	19: 47,680,420	Y122H	probably damaging	Het
Col28a1	G	A	6: 8,083,748	P570S	possibly damaging	Het
Dchs2	A	T	3: 83,346,236	I2318L	probably benign	Het
Dhx35	T	A	2: 158,818,299	Y184N	probably benign	Het
Dmxl1	T	G	18: 49,857,386	N297K	probably benign	Het
Dsp	G	A	13: 38,167,609	G135S	probably benign	Het
Efhb	C	T	17: 53,398,999	V837I	possibly damaging	Het
Efs	C	T	14: 54,921,157	D15N	probably damaging	Het
Fbxl19	C	T	7: 127,752,509	T314I	probably damaging	Het
Gm11595	A	T	11: 99,772,648	C69S	unknown	Het
Grxcr2	A	G	18: 41,986,678	V199A	probably benign	Het
Hadha	T	C	5: 30,123,684	E468G	probably benign	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Hps1	A	T	19: 42,770,778	V125E	probably damaging	Het
Hrg	A	T	16: 22,953,662	T74S	probably benign	Het
Idh3a	T	C	9: 54,586,545		probably null	Het
Leng8	C	A	7: 4,145,523		probably null	Het
Maml2	TCAGCAGCAGCAGCAGCAGC	TCAGCAGCAGCAGCAGC	9: 13,621,399		probably benign	Het
Mctp2	T	C	7: 72,259,103	H154R	probably benign	Het
Megf6	A	G	4: 154,263,179	E777G	probably benign	Het
Mgea5	A	G	19: 45,776,132	S190P	probably damaging	Het
Miip	A	G	4: 147,865,678	S154P	probably benign	Het
Mprip	T	C	11: 59,758,425	V985A	probably benign	Het
Nmrk2	G	A	10: 81,199,634	R158W	probably damaging	Het
Nsd2	T	C	5: 33,882,161	S180P	probably damaging	Het
Olfr1377	G	A	11: 50,984,804	M34I	probably benign	Het
Olfr66	A	G	7: 103,881,826	V139A	probably damaging	Het
Opa1	T	G	16: 29,615,134	S596A	probably damaging	Het
Pcdha2	A	G	18: 36,940,804	E496G	probably damaging	Het
Pcdhb5	T	G	18: 37,321,080	V171G	probably damaging	Het
Pramel6	A	G	2: 87,508,659	T68A	probably benign	Het
Ptprq	T	C	10: 107,582,358	Y1719C	probably damaging	Het
Pzp	T	C	6: 128,513,764	N412S	probably benign	Het
Rb1cc1	G	T	1: 6,249,834	R1159L	probably benign	Het
Rev3l	T	A	10: 39,824,150	S1548T	probably benign	Het
Rora	A	G	9: 69,378,802	I471M	probably benign	Het
Scube1	C	A	15: 83,651,676	V266L	probably benign	Het
Sema6a	C	T	18: 47,283,403	D386N	possibly damaging	Het
Siglecf	T	A	7: 43,355,006	L253Q	probably damaging	Het
Spata31d1b	A	G	13: 59,715,650	H204R	probably benign	Het
Syt17	T	C	7: 118,408,133	T313A	possibly damaging	Het
Tbc1d32	T	C	10: 56,162,208	T578A	possibly damaging	Het
Vmn2r9	T	A	5: 108,848,260	H174L	probably damaging	Het
Vrk2	A	T	11: 26,486,975	S281T	probably benign	Het
Wdr48	A	G	9: 119,907,777	D22G	probably damaging	Het
Zfp408	C	A	2: 91,649,291	V61L	probably benign	Het
Zfp652	G	A	11: 95,749,863	A205T	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

Posted On

2017-07-14