Incidental Mutation 'R6054:Rora'
ID484311
Institutional Source Beutler Lab
Gene Symbol Rora
Ensembl Gene ENSMUSG00000032238
Gene NameRAR-related orphan receptor alpha
Synonymstmgc26, Nr1f1, 9530021D13Rik
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location68653786-69388246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69378802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 471 (I471M)
Ref Sequence ENSEMBL: ENSMUSP00000034766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034766] [ENSMUST00000113624]
Predicted Effect probably benign
Transcript: ENSMUST00000034766
AA Change: I471M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034766
Gene: ENSMUSG00000032238
AA Change: I471M

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
ZnF_C4 70 141 4.71e-41 SMART
low complexity region 161 175 N/A INTRINSIC
HOLI 325 481 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113624
AA Change: I415M

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109254
Gene: ENSMUSG00000032238
AA Change: I415M

DomainStartEndE-ValueType
ZnF_C4 14 85 4.71e-41 SMART
low complexity region 105 119 N/A INTRINSIC
HOLI 269 425 8.8e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for null mutations exhibit ataxia, cerebellar dysgenesis, impaired Purkinje and granule cell development, olfactory defects, hypoalphalipoproteinemia, and death around 4 weeks. Heterozygotes show slow Purkinje cell dedritic atrophy and loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Rora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Rora APN 9 69371290 missense probably benign 0.31
IGL02355:Rora APN 9 69374092 missense probably damaging 1.00
IGL02362:Rora APN 9 69374092 missense probably damaging 1.00
PIT4696001:Rora UTSW 9 69364559 missense possibly damaging 0.92
R0091:Rora UTSW 9 69374048 missense probably damaging 1.00
R0555:Rora UTSW 9 69361746 missense probably damaging 1.00
R0609:Rora UTSW 9 69361869 missense probably damaging 1.00
R1483:Rora UTSW 9 69364385 missense probably benign 0.00
R1712:Rora UTSW 9 69375489 missense probably benign 0.23
R1785:Rora UTSW 9 69376837 missense probably benign 0.30
R2883:Rora UTSW 9 69375435 missense probably damaging 1.00
R4173:Rora UTSW 9 68653910 missense probably benign 0.41
R5226:Rora UTSW 9 69364141 intron probably benign
R5660:Rora UTSW 9 68653921 missense probably benign 0.27
R6029:Rora UTSW 9 69364452 missense probably benign 0.04
R6114:Rora UTSW 9 69371323 missense probably benign
R6329:Rora UTSW 9 69373186 missense probably damaging 1.00
R7028:Rora UTSW 9 69196083 missense possibly damaging 0.46
R7170:Rora UTSW 9 69373190 nonsense probably null
R7233:Rora UTSW 9 69197522 nonsense probably null
R7512:Rora UTSW 9 69374085 missense probably benign 0.00
Z1176:Rora UTSW 9 69364372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGCAAGAATACCTCTCGG -3'
(R):5'- TGTTCTAGAAGTGCTCGGGC -3'

Sequencing Primer
(F):5'- TTCTAAACGTATTTGGTCGATTCC -3'
(R):5'- GCGCGACATTTACCCATCG -3'
Posted On2017-07-14