Incidental Mutation 'R6054:Tbc1d32'
ID484314
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene NameTBC1 domain family, member 32
SynonymsD630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location56014293-56228689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56162208 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 578 (T578A)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099739
AA Change: T578A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: T578A

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAGGGAGTCTGAAGCACATACC -3'
(R):5'- CAGAAACCTTTGTCATGACTGGAC -3'

Sequencing Primer
(F):5'- GGAGTCTGAAGCACATACCTTCTTC -3'
(R):5'- TCATGACTGGACATGTGCAC -3'
Posted On2017-07-14