Incidental Mutation 'R6054:Efs'
ID484329
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Nameembryonal Fyn-associated substrate
Synonyms
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54916535-54926126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54921157 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 15 (D15N)
Ref Sequence ENSEMBL: ENSMUSP00000022813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000227037] [ENSMUST00000227587]
Predicted Effect probably damaging
Transcript: ENSMUST00000022813
AA Change: D15N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: D15N

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227037
Predicted Effect possibly damaging
Transcript: ENSMUST00000227587
AA Change: D15N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 54921042 missense probably damaging 1.00
IGL02720:Efs APN 14 54919715 missense probably damaging 1.00
IGL02752:Efs APN 14 54917423 missense probably damaging 0.96
R0129:Efs UTSW 14 54917223 missense probably damaging 1.00
R1522:Efs UTSW 14 54919715 missense probably damaging 1.00
R1927:Efs UTSW 14 54917163 missense possibly damaging 0.89
R2327:Efs UTSW 14 54917504 missense probably benign 0.01
R3431:Efs UTSW 14 54920224 missense probably damaging 1.00
R3432:Efs UTSW 14 54920224 missense probably damaging 1.00
R3615:Efs UTSW 14 54920095 missense probably damaging 1.00
R3616:Efs UTSW 14 54920095 missense probably damaging 1.00
R3756:Efs UTSW 14 54920422 splice site probably benign
R3945:Efs UTSW 14 54920651 splice site probably benign
R4448:Efs UTSW 14 54920192 missense probably damaging 1.00
R4717:Efs UTSW 14 54920344 missense probably damaging 0.99
R4819:Efs UTSW 14 54917153 missense probably damaging 0.98
R5656:Efs UTSW 14 54917127 missense probably damaging 1.00
R5946:Efs UTSW 14 54919494 intron probably null
R7457:Efs UTSW 14 54919994 missense probably benign
R7822:Efs UTSW 14 54917450 missense probably benign 0.09
X0028:Efs UTSW 14 54920621 nonsense probably null
Z1176:Efs UTSW 14 54920336 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATGATGAGCCAGGCTG -3'
(R):5'- AGGAGTGTGCCCTCCATGAC -3'

Sequencing Primer
(F):5'- TGCTGGGCAGAGGCTAG -3'
(R):5'- TCCATGACGCTGGCAGG -3'
Posted On2017-07-14