Incidental Mutation 'R0520:Atg9a'
ID 48433
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 038713-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0520 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 75163178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 299 (W299*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189702] [ENSMUST00000189665]
AlphaFold Q68FE2
Predicted Effect probably null
Transcript: ENSMUST00000040689
AA Change: W307*
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: W307*

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably null
Transcript: ENSMUST00000188347
AA Change: W307*
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: W307*

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189820
AA Change: W299*
Predicted Effect probably null
Transcript: ENSMUST00000189702
AA Change: W307*
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: W307*

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,288,952 (GRCm39) I154T possibly damaging Het
Acr G T 15: 89,457,430 (GRCm39) C226F probably damaging Het
Aff1 C T 5: 103,995,617 (GRCm39) R1070* probably null Het
Aldh9a1 C T 1: 167,188,960 (GRCm39) probably benign Het
Apaf1 A T 10: 90,915,851 (GRCm39) H12Q probably damaging Het
Asic1 A T 15: 99,593,416 (GRCm39) I291F probably damaging Het
Aspm T A 1: 139,406,558 (GRCm39) M1815K possibly damaging Het
Asxl3 A T 18: 22,656,043 (GRCm39) D1351V probably damaging Het
B3gntl1 C A 11: 121,514,314 (GRCm39) V313F possibly damaging Het
B4galnt4 T A 7: 140,647,286 (GRCm39) C345* probably null Het
Bicc1 A T 10: 70,793,020 (GRCm39) F211L probably damaging Het
Cachd1 T G 4: 100,754,900 (GRCm39) V117G probably damaging Het
Cdc16 G A 8: 13,810,569 (GRCm39) probably null Het
Cers6 C T 2: 68,935,435 (GRCm39) Q312* probably null Het
Csta2 A G 16: 36,073,461 (GRCm39) I16V probably benign Het
Dclre1c A G 2: 3,437,512 (GRCm39) H115R probably damaging Het
Ddx20 T C 3: 105,594,692 (GRCm39) T18A probably benign Het
Dhx57 A G 17: 80,565,604 (GRCm39) V816A possibly damaging Het
Dlgap1 C T 17: 70,823,989 (GRCm39) Q325* probably null Het
Dnaja1 A T 4: 40,728,072 (GRCm39) M178L probably benign Het
Ecd A T 14: 20,378,732 (GRCm39) S454T probably benign Het
Efcab6 G A 15: 83,834,247 (GRCm39) H454Y probably benign Het
Exo1 T A 1: 175,727,031 (GRCm39) D447E probably benign Het
F5 T G 1: 164,037,156 (GRCm39) I1965S probably benign Het
Fbn2 A G 18: 58,146,821 (GRCm39) C2692R probably damaging Het
Fggy T A 4: 95,489,340 (GRCm39) L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,250,812 (GRCm39) probably null Het
Gm9871 A G 6: 101,778,540 (GRCm39) noncoding transcript Het
Gnai2 A T 9: 107,497,372 (GRCm39) D7E probably benign Het
Gon7 C T 12: 102,724,047 (GRCm39) probably benign Het
H2-K2 A T 17: 34,216,390 (GRCm39) V272E probably damaging Het
Hectd4 G T 5: 121,469,770 (GRCm39) R2555L possibly damaging Het
Hexb T C 13: 97,317,618 (GRCm39) R360G probably benign Het
Igsf9b C A 9: 27,234,546 (GRCm39) S470R probably benign Het
Inpp5d T C 1: 87,633,642 (GRCm39) probably benign Het
Inpp5k C A 11: 75,530,356 (GRCm39) Y265* probably null Het
Klhl33 T G 14: 51,129,140 (GRCm39) E436D probably damaging Het
Krt80 A G 15: 101,267,898 (GRCm39) L13P probably benign Het
Krtap19-2 C T 16: 88,670,749 (GRCm39) probably benign Het
Marchf10 T C 11: 105,280,708 (GRCm39) T526A probably benign Het
Mcrs1 A G 15: 99,146,336 (GRCm39) probably null Het
Msh2 G T 17: 88,024,972 (GRCm39) V617F possibly damaging Het
Nckap1 A C 2: 80,371,874 (GRCm39) probably benign Het
Nek4 T A 14: 30,681,263 (GRCm39) probably benign Het
Or7h8 G A 9: 20,123,791 (GRCm39) V49I probably benign Het
Or8b12b T C 9: 37,684,849 (GRCm39) V298A probably benign Het
Or8k22 G T 2: 86,163,475 (GRCm39) T75K probably damaging Het
Or9s14 T A 1: 92,536,471 (GRCm39) V304E probably damaging Het
Osgin1 A G 8: 120,169,247 (GRCm39) H48R probably damaging Het
Pam T A 1: 97,811,920 (GRCm39) T369S probably benign Het
Pclo C T 5: 14,763,844 (GRCm39) Q821* probably null Het
Plekhm1 T C 11: 103,285,770 (GRCm39) I222V probably benign Het
Ptprg T G 14: 12,199,783 (GRCm38) N65K possibly damaging Het
Pum2 T A 12: 8,771,710 (GRCm39) V351E probably damaging Het
Slc25a54 T A 3: 109,014,546 (GRCm39) probably benign Het
Smchd1 A T 17: 71,736,538 (GRCm39) D587E possibly damaging Het
Stap1 A G 5: 86,238,823 (GRCm39) M164V probably benign Het
Stat5a T C 11: 100,752,252 (GRCm39) V30A probably damaging Het
Stk36 T G 1: 74,641,365 (GRCm39) probably benign Het
Tiam1 G T 16: 89,614,839 (GRCm39) probably benign Het
Tmc5 T C 7: 118,265,799 (GRCm39) M553T probably damaging Het
Tmem14a T A 1: 21,299,636 (GRCm39) Y89N possibly damaging Het
Tpp2 A G 1: 44,029,690 (GRCm39) Y991C probably damaging Het
Ttc7 A G 17: 87,666,579 (GRCm39) K615E possibly damaging Het
Ubac2 C T 14: 122,231,754 (GRCm39) P227S probably damaging Het
Vit A C 17: 78,932,588 (GRCm39) K565T probably damaging Het
Vps13c T C 9: 67,853,133 (GRCm39) F2409L possibly damaging Het
Wdr64 A G 1: 175,553,958 (GRCm39) T173A probably damaging Het
Zfp759 T C 13: 67,285,419 (GRCm39) I60T probably benign Het
Zfp81 A G 17: 33,553,351 (GRCm39) S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,713,776 (GRCm39) probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAATGCCACTCTGCTATTCCCAC -3'
(R):5'- TGGTGAACAAATCCCTCCTGCCTC -3'

Sequencing Primer
(F):5'- AGAAGGCACCATTCTTGGC -3'
(R):5'- GTGGCCTCAAGTACAACTTTG -3'
Posted On 2013-06-12