Incidental Mutation 'R6054:Adam28'
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Namea disintegrin and metallopeptidase domain 28
SynonymsD430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location68606027-68655842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68642152 bp
Amino Acid Change Asparagine to Isoleucine at position 149 (N149I)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
Predicted Effect probably benign
Transcript: ENSMUST00000022642
AA Change: N149I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: N149I

signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111072
AA Change: N149I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: N149I

signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224039
AA Change: N149I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224131
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R0959:Adam28 UTSW 14 68607938 missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4282:Adam28 UTSW 14 68647706 missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68642062 missense probably benign
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6449:Adam28 UTSW 14 68630667 missense probably benign 0.31
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6831:Adam28 UTSW 14 68618127 missense probably benign 0.04
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7411:Adam28 UTSW 14 68626947 missense probably damaging 1.00
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
R7649:Adam28 UTSW 14 68634833 missense probably benign 0.12
R7765:Adam28 UTSW 14 68609106 critical splice donor site probably null
R8469:Adam28 UTSW 14 68606580 missense probably benign 0.16
R8520:Adam28 UTSW 14 68642083 missense probably damaging 0.98
Z1177:Adam28 UTSW 14 68626784 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-07-14