Incidental Mutation 'R6054:Scube1'
ID484331
Institutional Source Beutler Lab
Gene Symbol Scube1
Ensembl Gene ENSMUSG00000016763
Gene Namesignal peptide, CUB domain, EGF-like 1
Synonyms7330410C13Rik, A630023E24Rik
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83604999-83725021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83651676 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 266 (V266L)
Ref Sequence ENSEMBL: ENSMUSP00000016907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]
Predicted Effect probably benign
Transcript: ENSMUST00000016907
AA Change: V266L

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763
AA Change: V266L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 274 311 1.69e-3 SMART
EGF_CA 312 352 2.13e-9 SMART
EGF_CA 353 391 4.7e-11 SMART
EGF_CA 392 432 3.91e-8 SMART
low complexity region 560 573 N/A INTRINSIC
Pfam:GCC2_GCC3 666 713 4.5e-13 PFAM
EGF_like 766 804 6.81e1 SMART
CUB 828 940 1.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043634
SMART Domains Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 163 200 1.69e-3 SMART
EGF_CA 201 241 2.13e-9 SMART
EGF_CA 242 280 4.7e-11 SMART
EGF_CA 281 321 3.91e-8 SMART
low complexity region 449 462 N/A INTRINSIC
Pfam:GCC2_GCC3 555 602 3.2e-11 PFAM
EGF_like 655 693 6.81e1 SMART
CUB 717 829 1.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076060
SMART Domains Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.3e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144773
Predicted Effect probably benign
Transcript: ENSMUST00000171496
SMART Domains Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.7e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229057
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Scube1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Scube1 APN 15 83703501 missense probably damaging 0.98
IGL01152:Scube1 APN 15 83613570 missense probably damaging 1.00
IGL01388:Scube1 APN 15 83620131 missense probably benign 0.00
IGL01589:Scube1 APN 15 83612553 missense probably damaging 1.00
IGL02208:Scube1 APN 15 83703540 missense probably damaging 1.00
IGL02305:Scube1 APN 15 83607390 missense probably damaging 1.00
IGL02728:Scube1 APN 15 83659016 splice site probably benign
IGL02737:Scube1 APN 15 83721843 splice site probably benign
IGL03326:Scube1 APN 15 83607416 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0126:Scube1 UTSW 15 83621063 missense probably damaging 1.00
R0792:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1438:Scube1 UTSW 15 83615026 missense possibly damaging 0.93
R1522:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1735:Scube1 UTSW 15 83607437 missense probably damaging 1.00
R1766:Scube1 UTSW 15 83721945 missense probably damaging 1.00
R1778:Scube1 UTSW 15 83610204 missense probably damaging 1.00
R2975:Scube1 UTSW 15 83659098 missense probably damaging 0.99
R4080:Scube1 UTSW 15 83608747 missense probably damaging 1.00
R4434:Scube1 UTSW 15 83721924 missense probably damaging 1.00
R5585:Scube1 UTSW 15 83676923 missense probably damaging 1.00
R5857:Scube1 UTSW 15 83607260 unclassified probably benign
R5977:Scube1 UTSW 15 83629488 missense probably damaging 1.00
R6461:Scube1 UTSW 15 83612427 missense probably damaging 1.00
R6956:Scube1 UTSW 15 83721876 missense probably damaging 1.00
R6959:Scube1 UTSW 15 83629435 missense probably benign 0.42
R7124:Scube1 UTSW 15 83629511 splice site probably null
R7267:Scube1 UTSW 15 83621065 missense probably damaging 1.00
R7404:Scube1 UTSW 15 83615010 missense probably damaging 0.98
R7584:Scube1 UTSW 15 83721887 nonsense probably null
R7585:Scube1 UTSW 15 83638787 missense possibly damaging 0.83
R7599:Scube1 UTSW 15 83613452 missense probably damaging 1.00
R8055:Scube1 UTSW 15 83659025 critical splice donor site probably null
X0022:Scube1 UTSW 15 83634669 critical splice donor site probably null
Z1177:Scube1 UTSW 15 83612416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACCAGCATCTGTACAGTC -3'
(R):5'- TGGAAGTTCCTGGGATGAGC -3'

Sequencing Primer
(F):5'- ATCTGTACAGTCCCGCATCAG -3'
(R):5'- CCCGGCATGCTGTGTTG -3'
Posted On2017-07-14