Incidental Mutation 'R6054:Hrg'
ID 484333
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Name histidine-rich glycoprotein
Synonyms D18020, D16JH2
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock # R6054 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 22951072-22961656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22953662 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 74 (T74S)
Ref Sequence ENSEMBL: ENSMUSP00000023590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023590
AA Change: T74S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: T74S

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232422
AA Change: T74S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Idh3a T C 9: 54,586,545 probably null Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22959159 critical splice acceptor site probably null
IGL02795:Hrg APN 16 22957553 unclassified probably benign
R0042:Hrg UTSW 16 22961136 unclassified probably benign
R0184:Hrg UTSW 16 22953771 critical splice donor site probably null
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1733:Hrg UTSW 16 22951247 missense probably damaging 1.00
R1828:Hrg UTSW 16 22956103 missense probably damaging 1.00
R1919:Hrg UTSW 16 22954457 missense probably damaging 1.00
R2104:Hrg UTSW 16 22956199 missense probably benign 0.09
R2281:Hrg UTSW 16 22961309 unclassified probably benign
R2447:Hrg UTSW 16 22961148 unclassified probably benign
R3962:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R3963:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R4571:Hrg UTSW 16 22961222 unclassified probably benign
R4903:Hrg UTSW 16 22961151 unclassified probably benign
R4904:Hrg UTSW 16 22951250 missense probably benign 0.03
R5236:Hrg UTSW 16 22961513 unclassified probably benign
R6020:Hrg UTSW 16 22954518 missense probably damaging 1.00
R6207:Hrg UTSW 16 22954538 critical splice donor site probably null
R6374:Hrg UTSW 16 22960992 missense probably damaging 0.98
R7516:Hrg UTSW 16 22961298 missense unknown
R7606:Hrg UTSW 16 22951123 start codon destroyed probably null 0.01
R8190:Hrg UTSW 16 22961043 missense unknown
R8349:Hrg UTSW 16 22961536 missense unknown
R8449:Hrg UTSW 16 22961536 missense unknown
R8973:Hrg UTSW 16 22959218 missense probably benign 0.22
R8998:Hrg UTSW 16 22953705 missense probably damaging 0.99
R9334:Hrg UTSW 16 22961311 missense unknown
Z1177:Hrg UTSW 16 22953712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGGAAAGGAAGATATTGCTTTT -3'
(R):5'- GTGGCTCCCGTGAGTGAG -3'

Sequencing Primer
(F):5'- GAGGACCCAGGTTCAATTTCCAG -3'
(R):5'- CGTGAGTGAGCGGACTAGAAG -3'
Posted On 2017-07-14