Mutagenetix > Incidental Mutation

Incidental Mutation 'R6056:Tlr5'

484355

Institutional Source

Beutler Lab

Gene Symbol

Tlr5

Ensembl Gene

ENSMUSG00000079164

Gene Name

toll-like receptor 5

Synonyms

MMRRC Submission

044223-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R6056 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

182954788-182976044 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 182974038 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 302 (R302S)

Ref Sequence

ENSEMBL: ENSMUSP00000141318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110997
AA Change: R302S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: R302S

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	3.11e-2	SMART
LRR	159	183	5.56e0	SMART
LRR	184	207	1.97e2	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	7.05e-1	SMART
LRR	350	373	2.92e1	SMART
LRR	374	397	2.54e1	SMART
LRR	398	418	1.29e2	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	1.06e-4	SMART
LRR	540	563	6.13e-1	SMART
LRR	564	585	2.21e2	SMART
LRRCT	594	645	7.01e-6	SMART
low complexity region	657	676	N/A	INTRINSIC
TIR	707	852	3.89e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191820
AA Change: R288S

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: R288S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
LRR_TYP	95	118	1.3e-4	SMART
LRR	145	169	2.3e-2	SMART
LRR	170	193	8.2e-1	SMART
low complexity region	248	261	N/A	INTRINSIC
LRR	312	335	2.9e-3	SMART
LRR	336	359	1.2e-1	SMART
LRR	360	383	1.1e-1	SMART
LRR	384	404	5.4e-1	SMART
low complexity region	427	442	N/A	INTRINSIC
LRR_TYP	502	525	4.5e-7	SMART
LRR	526	549	2.5e-3	SMART
LRR	550	571	9.4e-1	SMART
LRRCT	580	631	3.4e-8	SMART
transmembrane domain	642	664	N/A	INTRINSIC
TIR	693	838	2.5e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193539

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193687
AA Change: R302S

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: R302S

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	1.3e-4	SMART
LRR	159	183	2.3e-2	SMART
LRR	184	207	8.2e-1	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	2.9e-3	SMART
LRR	350	373	1.2e-1	SMART
LRR	374	397	1.1e-1	SMART
LRR	398	418	5.4e-1	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	4.5e-7	SMART
LRR	540	563	2.5e-3	SMART
LRR	564	585	9.4e-1	SMART
LRRCT	594	645	3.4e-8	SMART
transmembrane domain	656	678	N/A	INTRINSIC
TIR	707	852	2.5e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195603

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195614

Meta Mutation Damage Score

0.1076

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

96% (99/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,878	W162R	probably benign	Het
2610507B11Rik	C	A	11: 78,271,384	L691I	possibly damaging	Het
4930438A08Rik	C	A	11: 58,293,638	P394H	probably damaging	Het
Aggf1	C	T	13: 95,371,615	C81Y	probably benign	Het
Agxt2	A	T	15: 10,378,877	D188V	probably damaging	Het
Angpt2	T	C	8: 18,698,116	K376R	probably benign	Het
Anxa5	A	G	3: 36,450,691	S241P	probably damaging	Het
Aox3	A	T	1: 58,169,859	K850N	probably damaging	Het
Arid5a	T	C	1: 36,319,392	M415T	probably benign	Het
Aspa	T	A	11: 73,308,752	N233I	probably damaging	Het
Atp4b	C	T	8: 13,388,782	R198Q	probably damaging	Het
Atp8b2	A	T	3: 89,946,221	V719E	possibly damaging	Het
Cacna1s	T	G	1: 136,105,836	V1017G	probably damaging	Het
Chrna4	G	T	2: 181,029,442	Q174K	probably damaging	Het
Chrnb1	A	T	11: 69,786,939	V329D	probably damaging	Het
Chst14	T	C	2: 118,927,733	L336P	probably damaging	Het
Clec2e	T	C	6: 129,100,809	D22G	probably benign	Het
Csrnp2	A	C	15: 100,482,382	S343A	probably benign	Het
Dapl1	C	A	2: 59,484,713	A2E	probably damaging	Het
Dlec1	G	T	9: 119,121,923	R519L	probably damaging	Het
Dmgdh	T	A	13: 93,708,743	F415I	possibly damaging	Het
Dmgdh	T	C	13: 93,752,326	V824A	probably damaging	Het
Dnah11	T	G	12: 117,928,456	T3661P	probably benign	Het
Dnah3	A	G	7: 120,030,031	F1434L	probably damaging	Het
Dnajc11	C	A	4: 151,978,126		probably benign	Het
Dot1l	A	G	10: 80,786,095	E527G	probably damaging	Het
Drc7	T	C	8: 95,075,051	L680P	probably damaging	Het
Dysf	T	C	6: 84,106,862	Y742H	probably benign	Het
Ece1	A	G	4: 137,961,647	Y665C	probably damaging	Het
Emc1	A	G	4: 139,354,222	K54E	possibly damaging	Het
Enoph1	C	T	5: 100,067,901	T247M	probably damaging	Het
Exoc2	T	C	13: 30,900,829	K383R	probably benign	Het
Fam227b	A	T	2: 126,121,052	H181Q	probably damaging	Het
Fsip2	A	T	2: 82,985,673	M3917L	probably benign	Het
Gtf3a	T	A	5: 146,955,528		probably benign	Het
Hgfac	T	A	5: 35,041,629	C11*	probably null	Het
Hmcn1	C	A	1: 150,663,909	A2944S	probably damaging	Het
Hps5	T	A	7: 46,767,097	Y947F	probably benign	Het
Ighv2-5	A	T	12: 113,685,500	I111K	probably benign	Het
Inpp5e	A	T	2: 26,407,848	L247*	probably null	Het
Kbtbd11	T	C	8: 15,027,577	S59P	probably benign	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kif1a	T	C	1: 93,024,648	D1303G	probably damaging	Het
Kif7	A	G	7: 79,714,094	V22A	possibly damaging	Het
Lrit3	A	T	3: 129,789,355	C328S	probably damaging	Het
Lrrc37a	G	T	11: 103,497,658	Q2314K	unknown	Het
Lurap1	G	T	4: 116,137,402	P211T	possibly damaging	Het
Mbd2	T	A	18: 70,580,803	N5K	possibly damaging	Het
Mbtps1	A	C	8: 119,515,602	L894V	probably benign	Het
Mefv	G	A	16: 3,708,042	S787F	possibly damaging	Het
Miip	T	A	4: 147,862,335	I289F	probably damaging	Het
Mogat2	T	A	7: 99,223,513	I155F	possibly damaging	Het
Mpp3	C	A	11: 102,011,689		probably null	Het
Mrrf	A	G	2: 36,177,221	K220E	probably damaging	Het
Mtmr6	C	T	14: 60,298,170	P485L	probably damaging	Het
Mtor	G	A	4: 148,537,435	R1896K	probably benign	Het
Myh3	C	T	11: 67,087,545	P453S	probably benign	Het
Nebl	A	G	2: 17,450,234	V112A	probably benign	Het
Nmnat2	G	A	1: 153,074,734	W55*	probably null	Het
Nprl3	A	G	11: 32,267,432	S37P	probably damaging	Het
Olfr1246	T	C	2: 89,591,101	N5D	possibly damaging	Het
Oraov1	G	T	7: 144,915,286	V17L	possibly damaging	Het
Pcdhga4	T	G	18: 37,686,330	S311A	probably benign	Het
Pcdhgb6	T	C	18: 37,743,112	V291A	probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Peg3	T	C	7: 6,709,571	E884G	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Phf12	A	G	11: 78,009,515	T146A	probably benign	Het
Polr3k	C	G	2: 181,864,488	N10K	probably damaging	Het
Prickle4	C	A	17: 47,690,210	G144C	probably damaging	Het
Ptpn6	T	C	6: 124,732,435	Y25C	probably damaging	Het
Rad1	A	G	15: 10,488,074	I95V	probably damaging	Het
Rad23b	A	G	4: 55,382,540	T248A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rcc2	T	G	4: 140,717,024	V342G	possibly damaging	Het
Rgs3	G	T	4: 62,625,906	R136L	probably damaging	Het
Scube2	A	T	7: 109,833,013	C399*	probably null	Het
Serpinb3d	T	C	1: 107,079,722	Y178C	probably damaging	Het
Slc1a7	A	G	4: 108,012,261	T508A	probably benign	Het
Slc29a4	C	T	5: 142,720,077	R439C	probably damaging	Het
Sntg2	A	G	12: 30,312,561	I62T	probably benign	Het
Sowaha	G	A	11: 53,479,087	P274L	probably damaging	Het
Sptan1	A	G	2: 29,996,782	N869S	probably benign	Het
Stx18	C	A	5: 38,106,564	A64D	probably damaging	Het
Stxbp5	A	G	10: 9,770,686	V94A	probably benign	Het
Sult1a1	T	A	7: 126,676,452		probably null	Het
Susd1	G	T	4: 59,379,687	H313Q	possibly damaging	Het
Tdrd9	A	T	12: 111,985,041	K88N	probably damaging	Het
Tnr	C	T	1: 159,886,909	T786I	probably damaging	Het
Tprgl	A	G	4: 154,160,095	S148P	probably damaging	Het
Trpc4ap	T	A	2: 155,671,074	N127I	probably damaging	Het
Tulp2	T	A	7: 45,490,373		probably null	Het
Uggt2	C	T	14: 119,035,969		probably null	Het
Ulk4	T	A	9: 121,272,955	Y19F	probably damaging	Het
Upf1	T	C	8: 70,333,037	Y1053C	probably damaging	Het
Vars2	A	T	17: 35,665,788	H223Q	probably benign	Het
Vmn2r106	T	A	17: 20,267,544		probably null	Het
Ythdc2	T	A	18: 44,840,210	F305I	probably damaging	Het
Zfp281	T	C	1: 136,625,440	F52S	possibly damaging	Het
Zfp292	A	T	4: 34,809,784	C1087S	probably damaging	Het
Zfp335	A	T	2: 164,895,098		probably null	Het

Other mutations in Tlr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Tlr5	APN	1	182973829	missense	probably benign
IGL00940:Tlr5	APN	1	182974196	missense	possibly damaging	0.84
IGL01302:Tlr5	APN	1	182974748	missense	probably benign	0.00
IGL01480:Tlr5	APN	1	182973499	missense	probably benign	0.09
IGL01717:Tlr5	APN	1	182975398	missense	probably damaging	1.00
IGL01896:Tlr5	APN	1	182974879	missense	possibly damaging	0.64
IGL02083:Tlr5	APN	1	182973884	missense	possibly damaging	0.91
IGL02135:Tlr5	APN	1	182973254	missense	possibly damaging	0.82
R0464:Tlr5	UTSW	1	182973710	missense	probably benign	0.01
R0552:Tlr5	UTSW	1	182975696	splice site	probably null
R0556:Tlr5	UTSW	1	182974151	missense	probably damaging	1.00
R0639:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R0670:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R1014:Tlr5	UTSW	1	182975677	missense	probably benign	0.00
R1125:Tlr5	UTSW	1	182973892	missense	probably benign	0.00
R1563:Tlr5	UTSW	1	182975010	missense	probably benign	0.09
R1775:Tlr5	UTSW	1	182973722	missense	probably damaging	0.99
R1793:Tlr5	UTSW	1	182972447	missense	probably benign	0.00
R1991:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R1992:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R2114:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2116:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2225:Tlr5	UTSW	1	182972376	start gained	probably benign
R2265:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2266:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2268:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2882:Tlr5	UTSW	1	182973893	missense	probably damaging	1.00
R3695:Tlr5	UTSW	1	182975347	missense	probably damaging	1.00
R3747:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R3749:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R4084:Tlr5	UTSW	1	182974848	missense	possibly damaging	0.60
R4794:Tlr5	UTSW	1	182973896	missense	probably benign	0.00
R4895:Tlr5	UTSW	1	182974199	missense	probably damaging	1.00
R4964:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R4966:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R5496:Tlr5	UTSW	1	182973632	missense	probably damaging	1.00
R6715:Tlr5	UTSW	1	182972659	intron	probably benign
R6825:Tlr5	UTSW	1	182973044	intron	probably benign
R6961:Tlr5	UTSW	1	182973511	nonsense	probably null
R7135:Tlr5	UTSW	1	182975523	missense	possibly damaging	0.87
R7232:Tlr5	UTSW	1	182973499	missense	probably benign	0.09
R7255:Tlr5	UTSW	1	182974316	missense	probably damaging	1.00
R7257:Tlr5	UTSW	1	182974233	nonsense	probably null
R8887:Tlr5	UTSW	1	182973767	missense	probably benign	0.07
R9116:Tlr5	UTSW	1	182974595	missense	probably benign
R9224:Tlr5	UTSW	1	182975128	missense	probably benign	0.10
R9284:Tlr5	UTSW	1	182973812	missense	probably benign	0.00
Z1177:Tlr5	UTSW	1	182973817	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTAGATCTTTCTGAAAATGGCTGG -3'
(R):5'- ACGTAGGCTACTCTAGGAAGC -3'

Posted On

2017-07-14