Mutagenetix > Incidental Mutation

Incidental Mutation 'R6056:Mrrf'

484359

Institutional Source

Beutler Lab

Gene Symbol

Mrrf

Ensembl Gene

ENSMUSG00000026887

Gene Name

mitochondrial ribosome recycling factor

Synonyms

2400002D02Rik

MMRRC Submission

044223-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.497) question?

Stock #

R6056 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36136389-36190647 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36177221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 220 (K220E)

Ref Sequence

ENSEMBL: ENSMUSP00000028250 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028250]

AlphaFold

Q9D6S7

PDB Structure

Solution structure of RSGI RUH-021, a domain II of ribosome recycling factor from mouse cDNA [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028250
AA Change: K220E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028250
Gene: ENSMUSG00000026887
AA Change: K220E

Domain	Start	End	E-Value	Type
low complexity region	58	66	N/A	INTRINSIC
Pfam:RRF	99	261	3.1e-43	PFAM

Meta Mutation Damage Score

0.5376

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

96% (99/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribosome recycling factor, which is a component of the mitochondrial translational machinery. The encoded protein, along with mitochondrial elongation factor 2, functions in ribosomal recycling at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,878	W162R	probably benign	Het
2610507B11Rik	C	A	11: 78,271,384	L691I	possibly damaging	Het
4930438A08Rik	C	A	11: 58,293,638	P394H	probably damaging	Het
Aggf1	C	T	13: 95,371,615	C81Y	probably benign	Het
Agxt2	A	T	15: 10,378,877	D188V	probably damaging	Het
Angpt2	T	C	8: 18,698,116	K376R	probably benign	Het
Anxa5	A	G	3: 36,450,691	S241P	probably damaging	Het
Aox3	A	T	1: 58,169,859	K850N	probably damaging	Het
Arid5a	T	C	1: 36,319,392	M415T	probably benign	Het
Aspa	T	A	11: 73,308,752	N233I	probably damaging	Het
Atp4b	C	T	8: 13,388,782	R198Q	probably damaging	Het
Atp8b2	A	T	3: 89,946,221	V719E	possibly damaging	Het
Cacna1s	T	G	1: 136,105,836	V1017G	probably damaging	Het
Chrna4	G	T	2: 181,029,442	Q174K	probably damaging	Het
Chrnb1	A	T	11: 69,786,939	V329D	probably damaging	Het
Chst14	T	C	2: 118,927,733	L336P	probably damaging	Het
Clec2e	T	C	6: 129,100,809	D22G	probably benign	Het
Csrnp2	A	C	15: 100,482,382	S343A	probably benign	Het
Dapl1	C	A	2: 59,484,713	A2E	probably damaging	Het
Dlec1	G	T	9: 119,121,923	R519L	probably damaging	Het
Dmgdh	T	C	13: 93,752,326	V824A	probably damaging	Het
Dmgdh	T	A	13: 93,708,743	F415I	possibly damaging	Het
Dnah11	T	G	12: 117,928,456	T3661P	probably benign	Het
Dnah3	A	G	7: 120,030,031	F1434L	probably damaging	Het
Dnajc11	C	A	4: 151,978,126		probably benign	Het
Dot1l	A	G	10: 80,786,095	E527G	probably damaging	Het
Drc7	T	C	8: 95,075,051	L680P	probably damaging	Het
Dysf	T	C	6: 84,106,862	Y742H	probably benign	Het
Ece1	A	G	4: 137,961,647	Y665C	probably damaging	Het
Emc1	A	G	4: 139,354,222	K54E	possibly damaging	Het
Enoph1	C	T	5: 100,067,901	T247M	probably damaging	Het
Exoc2	T	C	13: 30,900,829	K383R	probably benign	Het
Fam227b	A	T	2: 126,121,052	H181Q	probably damaging	Het
Fsip2	A	T	2: 82,985,673	M3917L	probably benign	Het
Gtf3a	T	A	5: 146,955,528		probably benign	Het
Hgfac	T	A	5: 35,041,629	C11*	probably null	Het
Hmcn1	C	A	1: 150,663,909	A2944S	probably damaging	Het
Hps5	T	A	7: 46,767,097	Y947F	probably benign	Het
Ighv2-5	A	T	12: 113,685,500	I111K	probably benign	Het
Inpp5e	A	T	2: 26,407,848	L247*	probably null	Het
Kbtbd11	T	C	8: 15,027,577	S59P	probably benign	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kif1a	T	C	1: 93,024,648	D1303G	probably damaging	Het
Kif7	A	G	7: 79,714,094	V22A	possibly damaging	Het
Lrit3	A	T	3: 129,789,355	C328S	probably damaging	Het
Lrrc37a	G	T	11: 103,497,658	Q2314K	unknown	Het
Lurap1	G	T	4: 116,137,402	P211T	possibly damaging	Het
Mbd2	T	A	18: 70,580,803	N5K	possibly damaging	Het
Mbtps1	A	C	8: 119,515,602	L894V	probably benign	Het
Mefv	G	A	16: 3,708,042	S787F	possibly damaging	Het
Miip	T	A	4: 147,862,335	I289F	probably damaging	Het
Mogat2	T	A	7: 99,223,513	I155F	possibly damaging	Het
Mpp3	C	A	11: 102,011,689		probably null	Het
Mtmr6	C	T	14: 60,298,170	P485L	probably damaging	Het
Mtor	G	A	4: 148,537,435	R1896K	probably benign	Het
Myh3	C	T	11: 67,087,545	P453S	probably benign	Het
Nebl	A	G	2: 17,450,234	V112A	probably benign	Het
Nmnat2	G	A	1: 153,074,734	W55*	probably null	Het
Nprl3	A	G	11: 32,267,432	S37P	probably damaging	Het
Olfr1246	T	C	2: 89,591,101	N5D	possibly damaging	Het
Oraov1	G	T	7: 144,915,286	V17L	possibly damaging	Het
Pcdhga4	T	G	18: 37,686,330	S311A	probably benign	Het
Pcdhgb6	T	C	18: 37,743,112	V291A	probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Peg3	T	C	7: 6,709,571	E884G	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Phf12	A	G	11: 78,009,515	T146A	probably benign	Het
Polr3k	C	G	2: 181,864,488	N10K	probably damaging	Het
Prickle4	C	A	17: 47,690,210	G144C	probably damaging	Het
Ptpn6	T	C	6: 124,732,435	Y25C	probably damaging	Het
Rad1	A	G	15: 10,488,074	I95V	probably damaging	Het
Rad23b	A	G	4: 55,382,540	T248A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rcc2	T	G	4: 140,717,024	V342G	possibly damaging	Het
Rgs3	G	T	4: 62,625,906	R136L	probably damaging	Het
Scube2	A	T	7: 109,833,013	C399*	probably null	Het
Serpinb3d	T	C	1: 107,079,722	Y178C	probably damaging	Het
Slc1a7	A	G	4: 108,012,261	T508A	probably benign	Het
Slc29a4	C	T	5: 142,720,077	R439C	probably damaging	Het
Sntg2	A	G	12: 30,312,561	I62T	probably benign	Het
Sowaha	G	A	11: 53,479,087	P274L	probably damaging	Het
Sptan1	A	G	2: 29,996,782	N869S	probably benign	Het
Stx18	C	A	5: 38,106,564	A64D	probably damaging	Het
Stxbp5	A	G	10: 9,770,686	V94A	probably benign	Het
Sult1a1	T	A	7: 126,676,452		probably null	Het
Susd1	G	T	4: 59,379,687	H313Q	possibly damaging	Het
Tdrd9	A	T	12: 111,985,041	K88N	probably damaging	Het
Tlr5	A	C	1: 182,974,038	R302S	possibly damaging	Het
Tnr	C	T	1: 159,886,909	T786I	probably damaging	Het
Tprgl	A	G	4: 154,160,095	S148P	probably damaging	Het
Trpc4ap	T	A	2: 155,671,074	N127I	probably damaging	Het
Tulp2	T	A	7: 45,490,373		probably null	Het
Uggt2	C	T	14: 119,035,969		probably null	Het
Ulk4	T	A	9: 121,272,955	Y19F	probably damaging	Het
Upf1	T	C	8: 70,333,037	Y1053C	probably damaging	Het
Vars2	A	T	17: 35,665,788	H223Q	probably benign	Het
Vmn2r106	T	A	17: 20,267,544		probably null	Het
Ythdc2	T	A	18: 44,840,210	F305I	probably damaging	Het
Zfp281	T	C	1: 136,625,440	F52S	possibly damaging	Het
Zfp292	A	T	4: 34,809,784	C1087S	probably damaging	Het
Zfp335	A	T	2: 164,895,098		probably null	Het

Other mutations in Mrrf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Mrrf	APN	2	36141631	missense	possibly damaging	0.82
R0239:Mrrf	UTSW	2	36177281	splice site	probably benign
R0370:Mrrf	UTSW	2	36177113	critical splice acceptor site	probably null
R0671:Mrrf	UTSW	2	36153698	missense	probably benign	0.01
R2517:Mrrf	UTSW	2	36189097	missense	probably benign	0.07
R4823:Mrrf	UTSW	2	36148030	missense	possibly damaging	0.93
R5552:Mrrf	UTSW	2	36147961	missense	possibly damaging	0.85
R8269:Mrrf	UTSW	2	36147961	missense	possibly damaging	0.85
R8805:Mrrf	UTSW	2	36147953	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTTGGGCTAGTGAACAG -3'
(R):5'- GGTCTAACAGTGGGCTAGTC -3'

Posted On

2017-07-14