Incidental Mutation 'R6056:Olfr1246'
ID484362
Institutional Source Beutler Lab
Gene Symbol Olfr1246
Ensembl Gene ENSMUSG00000111715
Gene Nameolfactory receptor 1246
SynonymsGA_x6K02T2Q125-51034790-51033846, MOR231-9
MMRRC Submission 044223-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6056 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89586141-89593157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89591101 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 5 (N5D)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000187990
AA Change: N5D

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: N5D

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191053
AA Change: N5D

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140823
Gene: ENSMUSG00000100828
AA Change: N5D

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 1.9e-29 PFAM
Pfam:7tm_4 137 278 1.1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213221
AA Change: N5D

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217192
AA Change: N5D

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217254
AA Change: N5D

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.2278 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,878 W162R probably benign Het
2610507B11Rik C A 11: 78,271,384 L691I possibly damaging Het
4930438A08Rik C A 11: 58,293,638 P394H probably damaging Het
Aggf1 C T 13: 95,371,615 C81Y probably benign Het
Agxt2 A T 15: 10,378,877 D188V probably damaging Het
Angpt2 T C 8: 18,698,116 K376R probably benign Het
Anxa5 A G 3: 36,450,691 S241P probably damaging Het
Aox3 A T 1: 58,169,859 K850N probably damaging Het
Arid5a T C 1: 36,319,392 M415T probably benign Het
Aspa T A 11: 73,308,752 N233I probably damaging Het
Atp4b C T 8: 13,388,782 R198Q probably damaging Het
Atp8b2 A T 3: 89,946,221 V719E possibly damaging Het
Cacna1s T G 1: 136,105,836 V1017G probably damaging Het
Chrna4 G T 2: 181,029,442 Q174K probably damaging Het
Chrnb1 A T 11: 69,786,939 V329D probably damaging Het
Chst14 T C 2: 118,927,733 L336P probably damaging Het
Clec2e T C 6: 129,100,809 D22G probably benign Het
Csrnp2 A C 15: 100,482,382 S343A probably benign Het
Dapl1 C A 2: 59,484,713 A2E probably damaging Het
Dlec1 G T 9: 119,121,923 R519L probably damaging Het
Dmgdh T A 13: 93,708,743 F415I possibly damaging Het
Dmgdh T C 13: 93,752,326 V824A probably damaging Het
Dnah11 T G 12: 117,928,456 T3661P probably benign Het
Dnah3 A G 7: 120,030,031 F1434L probably damaging Het
Dnajc11 C A 4: 151,978,126 probably benign Het
Dot1l A G 10: 80,786,095 E527G probably damaging Het
Drc7 T C 8: 95,075,051 L680P probably damaging Het
Dysf T C 6: 84,106,862 Y742H probably benign Het
Ece1 A G 4: 137,961,647 Y665C probably damaging Het
Emc1 A G 4: 139,354,222 K54E possibly damaging Het
Enoph1 C T 5: 100,067,901 T247M probably damaging Het
Exoc2 T C 13: 30,900,829 K383R probably benign Het
Fam227b A T 2: 126,121,052 H181Q probably damaging Het
Fsip2 A T 2: 82,985,673 M3917L probably benign Het
Gtf3a T A 5: 146,955,528 probably benign Het
Hgfac T A 5: 35,041,629 C11* probably null Het
Hmcn1 C A 1: 150,663,909 A2944S probably damaging Het
Hps5 T A 7: 46,767,097 Y947F probably benign Het
Ighv2-5 A T 12: 113,685,500 I111K probably benign Het
Inpp5e A T 2: 26,407,848 L247* probably null Het
Kbtbd11 T C 8: 15,027,577 S59P probably benign Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kif1a T C 1: 93,024,648 D1303G probably damaging Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Lrit3 A T 3: 129,789,355 C328S probably damaging Het
Lrrc37a G T 11: 103,497,658 Q2314K unknown Het
Lurap1 G T 4: 116,137,402 P211T possibly damaging Het
Mbd2 T A 18: 70,580,803 N5K possibly damaging Het
Mbtps1 A C 8: 119,515,602 L894V probably benign Het
Mefv G A 16: 3,708,042 S787F possibly damaging Het
Miip T A 4: 147,862,335 I289F probably damaging Het
Mogat2 T A 7: 99,223,513 I155F possibly damaging Het
Mpp3 C A 11: 102,011,689 probably null Het
Mrrf A G 2: 36,177,221 K220E probably damaging Het
Mtmr6 C T 14: 60,298,170 P485L probably damaging Het
Mtor G A 4: 148,537,435 R1896K probably benign Het
Myh3 C T 11: 67,087,545 P453S probably benign Het
Nebl A G 2: 17,450,234 V112A probably benign Het
Nmnat2 G A 1: 153,074,734 W55* probably null Het
Nprl3 A G 11: 32,267,432 S37P probably damaging Het
Oraov1 G T 7: 144,915,286 V17L possibly damaging Het
Pcdhga4 T G 18: 37,686,330 S311A probably benign Het
Pcdhgb6 T C 18: 37,743,112 V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg3 T C 7: 6,709,571 E884G probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Phf12 A G 11: 78,009,515 T146A probably benign Het
Polr3k C G 2: 181,864,488 N10K probably damaging Het
Prickle4 C A 17: 47,690,210 G144C probably damaging Het
Ptpn6 T C 6: 124,732,435 Y25C probably damaging Het
Rad1 A G 15: 10,488,074 I95V probably damaging Het
Rad23b A G 4: 55,382,540 T248A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rcc2 T G 4: 140,717,024 V342G possibly damaging Het
Rgs3 G T 4: 62,625,906 R136L probably damaging Het
Scube2 A T 7: 109,833,013 C399* probably null Het
Serpinb3d T C 1: 107,079,722 Y178C probably damaging Het
Slc1a7 A G 4: 108,012,261 T508A probably benign Het
Slc29a4 C T 5: 142,720,077 R439C probably damaging Het
Sntg2 A G 12: 30,312,561 I62T probably benign Het
Sowaha G A 11: 53,479,087 P274L probably damaging Het
Sptan1 A G 2: 29,996,782 N869S probably benign Het
Stx18 C A 5: 38,106,564 A64D probably damaging Het
Stxbp5 A G 10: 9,770,686 V94A probably benign Het
Sult1a1 T A 7: 126,676,452 probably null Het
Susd1 G T 4: 59,379,687 H313Q possibly damaging Het
Tdrd9 A T 12: 111,985,041 K88N probably damaging Het
Tlr5 A C 1: 182,974,038 R302S possibly damaging Het
Tnr C T 1: 159,886,909 T786I probably damaging Het
Tprgl A G 4: 154,160,095 S148P probably damaging Het
Trpc4ap T A 2: 155,671,074 N127I probably damaging Het
Tulp2 T A 7: 45,490,373 probably null Het
Uggt2 C T 14: 119,035,969 probably null Het
Ulk4 T A 9: 121,272,955 Y19F probably damaging Het
Upf1 T C 8: 70,333,037 Y1053C probably damaging Het
Vars2 A T 17: 35,665,788 H223Q probably benign Het
Vmn2r106 T A 17: 20,267,544 probably null Het
Ythdc2 T A 18: 44,840,210 F305I probably damaging Het
Zfp281 T C 1: 136,625,440 F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp335 A T 2: 164,895,098 probably null Het
Other mutations in Olfr1246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr1246 APN 2 89590242 missense probably damaging 1.00
IGL02184:Olfr1246 APN 2 89590293 missense probably damaging 0.99
IGL03383:Olfr1246 APN 2 89590312 missense probably benign 0.24
PIT4283001:Olfr1246 UTSW 2 89590228 missense probably benign 0.01
R0453:Olfr1246 UTSW 2 89590751 nonsense probably null
R1614:Olfr1246 UTSW 2 89590696 missense possibly damaging 0.76
R2310:Olfr1246 UTSW 2 89590450 missense probably damaging 0.99
R2436:Olfr1246 UTSW 2 89590773 missense probably benign 0.42
R3683:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R3685:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R4037:Olfr1246 UTSW 2 89591035 missense probably benign 0.02
R5219:Olfr1246 UTSW 2 89590702 missense probably benign 0.03
R5350:Olfr1246 UTSW 2 89591088 missense possibly damaging 0.59
R5383:Olfr1246 UTSW 2 89591113 start codon destroyed probably null 0.91
R5639:Olfr1246 UTSW 2 89590725 missense probably damaging 1.00
R5927:Olfr1246 UTSW 2 89591100 missense possibly damaging 0.93
R6177:Olfr1246 UTSW 2 89590317 missense possibly damaging 0.78
R7351:Olfr1246 UTSW 2 89590513 missense probably benign 0.32
R7496:Olfr1246 UTSW 2 89590696 missense probably benign 0.05
R7583:Olfr1246 UTSW 2 89590751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCATGCAAGCTGTGAAGG -3'
(R):5'- GAGGTCGTGAGAAACAGTTCTAC -3'

Posted On2017-07-14