Incidental Mutation 'R6056:Lrit3'
ID 484370
Institutional Source Beutler Lab
Gene Symbol Lrit3
Ensembl Gene ENSMUSG00000093865
Gene Name leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Synonyms LOC242235
MMRRC Submission 044223-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6056 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 129581530-129597679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129583004 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 328 (C328S)
Ref Sequence ENSEMBL: ENSMUSP00000140184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179187] [ENSMUST00000185462]
AlphaFold W8DXL4
Predicted Effect probably benign
Transcript: ENSMUST00000179187
SMART Domains Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 2.7e-1 SMART
LRR 80 103 6.96e0 SMART
LRR 104 127 3.27e1 SMART
LRR_TYP 128 151 4.47e-3 SMART
LRR_TYP 152 175 7.37e-4 SMART
LRRCT 201 252 4.65e-2 SMART
Blast:IG 260 297 9e-13 BLAST
low complexity region 298 311 N/A INTRINSIC
FN3 364 443 1.85e0 SMART
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185462
AA Change: C328S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: C328S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 1.3e-3 SMART
LRR 80 103 2.9e-2 SMART
LRR 104 127 1.4e-1 SMART
LRR_TYP 128 151 1.9e-5 SMART
LRR_TYP 152 175 3.2e-6 SMART
LRRCT 201 252 2.3e-4 SMART
IGc2 266 335 4.7e-11 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 362 376 N/A INTRINSIC
low complexity region 408 432 N/A INTRINSIC
FN3 485 564 9e-3 SMART
transmembrane domain 583 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188978
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,115 (GRCm39) W162R probably benign Het
4930438A08Rik C A 11: 58,184,464 (GRCm39) P394H probably damaging Het
Aggf1 C T 13: 95,508,123 (GRCm39) C81Y probably benign Het
Agxt2 A T 15: 10,378,963 (GRCm39) D188V probably damaging Het
Angpt2 T C 8: 18,748,132 (GRCm39) K376R probably benign Het
Anxa5 A G 3: 36,504,840 (GRCm39) S241P probably damaging Het
Aox3 A T 1: 58,209,018 (GRCm39) K850N probably damaging Het
Arid5a T C 1: 36,358,473 (GRCm39) M415T probably benign Het
Aspa T A 11: 73,199,578 (GRCm39) N233I probably damaging Het
Atp4b C T 8: 13,438,782 (GRCm39) R198Q probably damaging Het
Atp8b2 A T 3: 89,853,528 (GRCm39) V719E possibly damaging Het
Bltp2 C A 11: 78,162,210 (GRCm39) L691I possibly damaging Het
Cacna1s T G 1: 136,033,574 (GRCm39) V1017G probably damaging Het
Chrna4 G T 2: 180,671,235 (GRCm39) Q174K probably damaging Het
Chrnb1 A T 11: 69,677,765 (GRCm39) V329D probably damaging Het
Chst14 T C 2: 118,758,214 (GRCm39) L336P probably damaging Het
Clec2e T C 6: 129,077,772 (GRCm39) D22G probably benign Het
Csrnp2 A C 15: 100,380,263 (GRCm39) S343A probably benign Het
Dapl1 C A 2: 59,315,057 (GRCm39) A2E probably damaging Het
Dlec1 G T 9: 118,950,991 (GRCm39) R519L probably damaging Het
Dmgdh T A 13: 93,845,251 (GRCm39) F415I possibly damaging Het
Dmgdh T C 13: 93,888,834 (GRCm39) V824A probably damaging Het
Dnah11 T G 12: 117,892,191 (GRCm39) T3661P probably benign Het
Dnah3 A G 7: 119,629,254 (GRCm39) F1434L probably damaging Het
Dnajc11 C A 4: 152,062,583 (GRCm39) probably benign Het
Dot1l A G 10: 80,621,929 (GRCm39) E527G probably damaging Het
Drc7 T C 8: 95,801,679 (GRCm39) L680P probably damaging Het
Dysf T C 6: 84,083,844 (GRCm39) Y742H probably benign Het
Ece1 A G 4: 137,688,958 (GRCm39) Y665C probably damaging Het
Emc1 A G 4: 139,081,533 (GRCm39) K54E possibly damaging Het
Enoph1 C T 5: 100,215,760 (GRCm39) T247M probably damaging Het
Exoc2 T C 13: 31,084,812 (GRCm39) K383R probably benign Het
Fam227b A T 2: 125,962,972 (GRCm39) H181Q probably damaging Het
Fsip2 A T 2: 82,816,017 (GRCm39) M3917L probably benign Het
Gtf3a T A 5: 146,892,338 (GRCm39) probably benign Het
Hgfac T A 5: 35,198,973 (GRCm39) C11* probably null Het
Hmcn1 C A 1: 150,539,660 (GRCm39) A2944S probably damaging Het
Hps5 T A 7: 46,416,521 (GRCm39) Y947F probably benign Het
Ighv2-5 A T 12: 113,649,120 (GRCm39) I111K probably benign Het
Inpp5e A T 2: 26,297,860 (GRCm39) L247* probably null Het
Kbtbd11 T C 8: 15,077,577 (GRCm39) S59P probably benign Het
Kctd19 G A 8: 106,123,082 (GRCm39) H111Y probably damaging Het
Kif1a T C 1: 92,952,370 (GRCm39) D1303G probably damaging Het
Kif7 A G 7: 79,363,842 (GRCm39) V22A possibly damaging Het
Lrrc37a G T 11: 103,388,484 (GRCm39) Q2314K unknown Het
LTO1 G T 7: 144,469,023 (GRCm39) V17L possibly damaging Het
Lurap1 G T 4: 115,994,599 (GRCm39) P211T possibly damaging Het
Mbd2 T A 18: 70,713,874 (GRCm39) N5K possibly damaging Het
Mbtps1 A C 8: 120,242,341 (GRCm39) L894V probably benign Het
Mefv G A 16: 3,525,906 (GRCm39) S787F possibly damaging Het
Miip T A 4: 147,946,792 (GRCm39) I289F probably damaging Het
Mogat2 T A 7: 98,872,720 (GRCm39) I155F possibly damaging Het
Mpp3 C A 11: 101,902,515 (GRCm39) probably null Het
Mrrf A G 2: 36,067,233 (GRCm39) K220E probably damaging Het
Mtmr6 C T 14: 60,535,619 (GRCm39) P485L probably damaging Het
Mtor G A 4: 148,621,892 (GRCm39) R1896K probably benign Het
Myh3 C T 11: 66,978,371 (GRCm39) P453S probably benign Het
Nebl A G 2: 17,455,045 (GRCm39) V112A probably benign Het
Nmnat2 G A 1: 152,950,480 (GRCm39) W55* probably null Het
Nprl3 A G 11: 32,217,432 (GRCm39) S37P probably damaging Het
Or4a73 T C 2: 89,421,445 (GRCm39) N5D possibly damaging Het
Pcdhga4 T G 18: 37,819,383 (GRCm39) S311A probably benign Het
Pcdhgb6 T C 18: 37,876,165 (GRCm39) V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Peg3 T C 7: 6,712,570 (GRCm39) E884G probably damaging Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Phf12 A G 11: 77,900,341 (GRCm39) T146A probably benign Het
Polr3k C G 2: 181,506,281 (GRCm39) N10K probably damaging Het
Prickle4 C A 17: 48,001,135 (GRCm39) G144C probably damaging Het
Ptpn6 T C 6: 124,709,398 (GRCm39) Y25C probably damaging Het
Rad1 A G 15: 10,488,160 (GRCm39) I95V probably damaging Het
Rad23b A G 4: 55,382,540 (GRCm39) T248A probably benign Het
Rapgef3 T C 15: 97,656,742 (GRCm39) D299G probably damaging Het
Rcc2 T G 4: 140,444,335 (GRCm39) V342G possibly damaging Het
Rgs3 G T 4: 62,544,143 (GRCm39) R136L probably damaging Het
Scube2 A T 7: 109,432,220 (GRCm39) C399* probably null Het
Serpinb3d T C 1: 107,007,452 (GRCm39) Y178C probably damaging Het
Slc1a7 A G 4: 107,869,458 (GRCm39) T508A probably benign Het
Slc29a4 C T 5: 142,705,832 (GRCm39) R439C probably damaging Het
Sntg2 A G 12: 30,362,560 (GRCm39) I62T probably benign Het
Sowaha G A 11: 53,369,914 (GRCm39) P274L probably damaging Het
Sptan1 A G 2: 29,886,794 (GRCm39) N869S probably benign Het
Stx18 C A 5: 38,263,908 (GRCm39) A64D probably damaging Het
Stxbp5 A G 10: 9,646,430 (GRCm39) V94A probably benign Het
Sult1a1 T A 7: 126,275,624 (GRCm39) probably null Het
Susd1 G T 4: 59,379,687 (GRCm39) H313Q possibly damaging Het
Tdrd9 A T 12: 111,951,475 (GRCm39) K88N probably damaging Het
Tlr5 A C 1: 182,801,603 (GRCm39) R302S possibly damaging Het
Tnr C T 1: 159,714,479 (GRCm39) T786I probably damaging Het
Tprg1l A G 4: 154,244,552 (GRCm39) S148P probably damaging Het
Trpc4ap T A 2: 155,512,994 (GRCm39) N127I probably damaging Het
Tulp2 T A 7: 45,139,797 (GRCm39) probably null Het
Uggt2 C T 14: 119,273,381 (GRCm39) probably null Het
Ulk4 T A 9: 121,102,021 (GRCm39) Y19F probably damaging Het
Upf1 T C 8: 70,785,687 (GRCm39) Y1053C probably damaging Het
Vars2 A T 17: 35,976,680 (GRCm39) H223Q probably benign Het
Vmn2r106 T A 17: 20,487,806 (GRCm39) probably null Het
Ythdc2 T A 18: 44,973,277 (GRCm39) F305I probably damaging Het
Zfp281 T C 1: 136,553,178 (GRCm39) F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 (GRCm39) C1087S probably damaging Het
Zfp335 A T 2: 164,737,018 (GRCm39) probably null Het
Other mutations in Lrit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Lrit3 UTSW 3 129,582,468 (GRCm39) small insertion probably benign
FR4340:Lrit3 UTSW 3 129,582,457 (GRCm39) small insertion probably benign
FR4548:Lrit3 UTSW 3 129,582,465 (GRCm39) small insertion probably benign
FR4548:Lrit3 UTSW 3 129,582,462 (GRCm39) small insertion probably benign
FR4589:Lrit3 UTSW 3 129,597,562 (GRCm39) frame shift probably null
FR4737:Lrit3 UTSW 3 129,597,562 (GRCm39) frame shift probably null
FR4737:Lrit3 UTSW 3 129,582,459 (GRCm39) small insertion probably benign
FR4737:Lrit3 UTSW 3 129,582,455 (GRCm39) small insertion probably benign
FR4976:Lrit3 UTSW 3 129,597,559 (GRCm39) unclassified probably benign
R0555:Lrit3 UTSW 3 129,584,945 (GRCm39) missense probably damaging 1.00
R0629:Lrit3 UTSW 3 129,581,951 (GRCm39) missense probably damaging 1.00
R0631:Lrit3 UTSW 3 129,582,204 (GRCm39) missense probably damaging 1.00
R1690:Lrit3 UTSW 3 129,594,394 (GRCm39) missense probably damaging 0.99
R1902:Lrit3 UTSW 3 129,584,895 (GRCm39) missense probably benign 0.17
R1955:Lrit3 UTSW 3 129,594,130 (GRCm39) missense probably benign 0.11
R3155:Lrit3 UTSW 3 129,585,044 (GRCm39) missense probably benign 0.00
R4005:Lrit3 UTSW 3 129,585,021 (GRCm39) missense probably benign 0.14
R4445:Lrit3 UTSW 3 129,582,180 (GRCm39) nonsense probably null
R4675:Lrit3 UTSW 3 129,582,121 (GRCm39) missense probably damaging 1.00
R5104:Lrit3 UTSW 3 129,582,040 (GRCm39) missense possibly damaging 0.86
R5147:Lrit3 UTSW 3 129,597,574 (GRCm39) missense possibly damaging 0.78
R5271:Lrit3 UTSW 3 129,581,950 (GRCm39) missense probably damaging 1.00
R5505:Lrit3 UTSW 3 129,585,087 (GRCm39) missense possibly damaging 0.83
R5587:Lrit3 UTSW 3 129,582,547 (GRCm39) missense probably benign 0.25
R6239:Lrit3 UTSW 3 129,593,995 (GRCm39) missense probably damaging 0.98
R6280:Lrit3 UTSW 3 129,582,412 (GRCm39) missense probably damaging 0.99
R6305:Lrit3 UTSW 3 129,594,109 (GRCm39) missense probably damaging 0.98
R6441:Lrit3 UTSW 3 129,594,009 (GRCm39) missense probably benign
R6947:Lrit3 UTSW 3 129,582,883 (GRCm39) missense probably benign 0.01
R6949:Lrit3 UTSW 3 129,582,934 (GRCm39) missense probably damaging 1.00
R7850:Lrit3 UTSW 3 129,594,452 (GRCm39) missense probably damaging 1.00
R8157:Lrit3 UTSW 3 129,594,284 (GRCm39) missense probably benign 0.00
R8405:Lrit3 UTSW 3 129,582,301 (GRCm39) missense probably benign 0.26
R8896:Lrit3 UTSW 3 129,585,132 (GRCm39) missense probably damaging 1.00
R8937:Lrit3 UTSW 3 129,594,193 (GRCm39) missense probably damaging 1.00
R9794:Lrit3 UTSW 3 129,594,073 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGTGATAACCAGGATTTAGATG -3'
(R):5'- TTACTGTGGCCAGGATCTCC -3'

Posted On 2017-07-14