Incidental Mutation 'R6056:Zfp292'
ID 484371
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Name zinc finger protein 292
Synonyms Zfp-15, 9430062L07Rik, Zn-16, Zfp15, Zn-15, 5730450D02Rik, Krox-10
MMRRC Submission 044223-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.861) question?
Stock # R6056 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 34803113-34882960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34809784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1087 (C1087S)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
AlphaFold Q9Z2U2
Predicted Effect probably damaging
Transcript: ENSMUST00000047950
AA Change: C1092S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: C1092S

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098163
AA Change: C1087S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: C1087S

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Meta Mutation Damage Score 0.8933 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,115 (GRCm39) W162R probably benign Het
4930438A08Rik C A 11: 58,184,464 (GRCm39) P394H probably damaging Het
Aggf1 C T 13: 95,508,123 (GRCm39) C81Y probably benign Het
Agxt2 A T 15: 10,378,963 (GRCm39) D188V probably damaging Het
Angpt2 T C 8: 18,748,132 (GRCm39) K376R probably benign Het
Anxa5 A G 3: 36,504,840 (GRCm39) S241P probably damaging Het
Aox3 A T 1: 58,209,018 (GRCm39) K850N probably damaging Het
Arid5a T C 1: 36,358,473 (GRCm39) M415T probably benign Het
Aspa T A 11: 73,199,578 (GRCm39) N233I probably damaging Het
Atp4b C T 8: 13,438,782 (GRCm39) R198Q probably damaging Het
Atp8b2 A T 3: 89,853,528 (GRCm39) V719E possibly damaging Het
Bltp2 C A 11: 78,162,210 (GRCm39) L691I possibly damaging Het
Cacna1s T G 1: 136,033,574 (GRCm39) V1017G probably damaging Het
Chrna4 G T 2: 180,671,235 (GRCm39) Q174K probably damaging Het
Chrnb1 A T 11: 69,677,765 (GRCm39) V329D probably damaging Het
Chst14 T C 2: 118,758,214 (GRCm39) L336P probably damaging Het
Clec2e T C 6: 129,077,772 (GRCm39) D22G probably benign Het
Csrnp2 A C 15: 100,380,263 (GRCm39) S343A probably benign Het
Dapl1 C A 2: 59,315,057 (GRCm39) A2E probably damaging Het
Dlec1 G T 9: 118,950,991 (GRCm39) R519L probably damaging Het
Dmgdh T A 13: 93,845,251 (GRCm39) F415I possibly damaging Het
Dmgdh T C 13: 93,888,834 (GRCm39) V824A probably damaging Het
Dnah11 T G 12: 117,892,191 (GRCm39) T3661P probably benign Het
Dnah3 A G 7: 119,629,254 (GRCm39) F1434L probably damaging Het
Dnajc11 C A 4: 152,062,583 (GRCm39) probably benign Het
Dot1l A G 10: 80,621,929 (GRCm39) E527G probably damaging Het
Drc7 T C 8: 95,801,679 (GRCm39) L680P probably damaging Het
Dysf T C 6: 84,083,844 (GRCm39) Y742H probably benign Het
Ece1 A G 4: 137,688,958 (GRCm39) Y665C probably damaging Het
Emc1 A G 4: 139,081,533 (GRCm39) K54E possibly damaging Het
Enoph1 C T 5: 100,215,760 (GRCm39) T247M probably damaging Het
Exoc2 T C 13: 31,084,812 (GRCm39) K383R probably benign Het
Fam227b A T 2: 125,962,972 (GRCm39) H181Q probably damaging Het
Fsip2 A T 2: 82,816,017 (GRCm39) M3917L probably benign Het
Gtf3a T A 5: 146,892,338 (GRCm39) probably benign Het
Hgfac T A 5: 35,198,973 (GRCm39) C11* probably null Het
Hmcn1 C A 1: 150,539,660 (GRCm39) A2944S probably damaging Het
Hps5 T A 7: 46,416,521 (GRCm39) Y947F probably benign Het
Ighv2-5 A T 12: 113,649,120 (GRCm39) I111K probably benign Het
Inpp5e A T 2: 26,297,860 (GRCm39) L247* probably null Het
Kbtbd11 T C 8: 15,077,577 (GRCm39) S59P probably benign Het
Kctd19 G A 8: 106,123,082 (GRCm39) H111Y probably damaging Het
Kif1a T C 1: 92,952,370 (GRCm39) D1303G probably damaging Het
Kif7 A G 7: 79,363,842 (GRCm39) V22A possibly damaging Het
Lrit3 A T 3: 129,583,004 (GRCm39) C328S probably damaging Het
Lrrc37a G T 11: 103,388,484 (GRCm39) Q2314K unknown Het
LTO1 G T 7: 144,469,023 (GRCm39) V17L possibly damaging Het
Lurap1 G T 4: 115,994,599 (GRCm39) P211T possibly damaging Het
Mbd2 T A 18: 70,713,874 (GRCm39) N5K possibly damaging Het
Mbtps1 A C 8: 120,242,341 (GRCm39) L894V probably benign Het
Mefv G A 16: 3,525,906 (GRCm39) S787F possibly damaging Het
Miip T A 4: 147,946,792 (GRCm39) I289F probably damaging Het
Mogat2 T A 7: 98,872,720 (GRCm39) I155F possibly damaging Het
Mpp3 C A 11: 101,902,515 (GRCm39) probably null Het
Mrrf A G 2: 36,067,233 (GRCm39) K220E probably damaging Het
Mtmr6 C T 14: 60,535,619 (GRCm39) P485L probably damaging Het
Mtor G A 4: 148,621,892 (GRCm39) R1896K probably benign Het
Myh3 C T 11: 66,978,371 (GRCm39) P453S probably benign Het
Nebl A G 2: 17,455,045 (GRCm39) V112A probably benign Het
Nmnat2 G A 1: 152,950,480 (GRCm39) W55* probably null Het
Nprl3 A G 11: 32,217,432 (GRCm39) S37P probably damaging Het
Or4a73 T C 2: 89,421,445 (GRCm39) N5D possibly damaging Het
Pcdhga4 T G 18: 37,819,383 (GRCm39) S311A probably benign Het
Pcdhgb6 T C 18: 37,876,165 (GRCm39) V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Peg3 T C 7: 6,712,570 (GRCm39) E884G probably damaging Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Phf12 A G 11: 77,900,341 (GRCm39) T146A probably benign Het
Polr3k C G 2: 181,506,281 (GRCm39) N10K probably damaging Het
Prickle4 C A 17: 48,001,135 (GRCm39) G144C probably damaging Het
Ptpn6 T C 6: 124,709,398 (GRCm39) Y25C probably damaging Het
Rad1 A G 15: 10,488,160 (GRCm39) I95V probably damaging Het
Rad23b A G 4: 55,382,540 (GRCm39) T248A probably benign Het
Rapgef3 T C 15: 97,656,742 (GRCm39) D299G probably damaging Het
Rcc2 T G 4: 140,444,335 (GRCm39) V342G possibly damaging Het
Rgs3 G T 4: 62,544,143 (GRCm39) R136L probably damaging Het
Scube2 A T 7: 109,432,220 (GRCm39) C399* probably null Het
Serpinb3d T C 1: 107,007,452 (GRCm39) Y178C probably damaging Het
Slc1a7 A G 4: 107,869,458 (GRCm39) T508A probably benign Het
Slc29a4 C T 5: 142,705,832 (GRCm39) R439C probably damaging Het
Sntg2 A G 12: 30,362,560 (GRCm39) I62T probably benign Het
Sowaha G A 11: 53,369,914 (GRCm39) P274L probably damaging Het
Sptan1 A G 2: 29,886,794 (GRCm39) N869S probably benign Het
Stx18 C A 5: 38,263,908 (GRCm39) A64D probably damaging Het
Stxbp5 A G 10: 9,646,430 (GRCm39) V94A probably benign Het
Sult1a1 T A 7: 126,275,624 (GRCm39) probably null Het
Susd1 G T 4: 59,379,687 (GRCm39) H313Q possibly damaging Het
Tdrd9 A T 12: 111,951,475 (GRCm39) K88N probably damaging Het
Tlr5 A C 1: 182,801,603 (GRCm39) R302S possibly damaging Het
Tnr C T 1: 159,714,479 (GRCm39) T786I probably damaging Het
Tprg1l A G 4: 154,244,552 (GRCm39) S148P probably damaging Het
Trpc4ap T A 2: 155,512,994 (GRCm39) N127I probably damaging Het
Tulp2 T A 7: 45,139,797 (GRCm39) probably null Het
Uggt2 C T 14: 119,273,381 (GRCm39) probably null Het
Ulk4 T A 9: 121,102,021 (GRCm39) Y19F probably damaging Het
Upf1 T C 8: 70,785,687 (GRCm39) Y1053C probably damaging Het
Vars2 A T 17: 35,976,680 (GRCm39) H223Q probably benign Het
Vmn2r106 T A 17: 20,487,806 (GRCm39) probably null Het
Ythdc2 T A 18: 44,973,277 (GRCm39) F305I probably damaging Het
Zfp281 T C 1: 136,553,178 (GRCm39) F52S possibly damaging Het
Zfp335 A T 2: 164,737,018 (GRCm39) probably null Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34,808,683 (GRCm39) missense probably benign 0.15
IGL00502:Zfp292 APN 4 34,809,775 (GRCm39) missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34,808,790 (GRCm39) missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34,807,827 (GRCm39) missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34,806,763 (GRCm39) missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34,807,961 (GRCm39) missense probably benign 0.01
IGL01639:Zfp292 APN 4 34,809,048 (GRCm39) missense probably benign 0.04
IGL01688:Zfp292 APN 4 34,807,855 (GRCm39) missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34,809,244 (GRCm39) missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34,808,810 (GRCm39) missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34,805,416 (GRCm39) missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34,806,462 (GRCm39) missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34,809,415 (GRCm39) missense probably benign 0.14
IGL02715:Zfp292 APN 4 34,819,542 (GRCm39) missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34,806,163 (GRCm39) missense probably benign 0.00
F5770:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34,807,524 (GRCm39) missense probably benign 0.00
R0153:Zfp292 UTSW 4 34,811,185 (GRCm39) missense probably benign 0.26
R0184:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34,806,281 (GRCm39) missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34,808,227 (GRCm39) missense probably benign 0.25
R0433:Zfp292 UTSW 4 34,839,959 (GRCm39) missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34,810,059 (GRCm39) missense probably benign 0.28
R0555:Zfp292 UTSW 4 34,807,194 (GRCm39) missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34,807,399 (GRCm39) missense probably benign 0.02
R0748:Zfp292 UTSW 4 34,816,424 (GRCm39) splice site probably benign
R0782:Zfp292 UTSW 4 34,839,382 (GRCm39) missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34,809,114 (GRCm39) missense probably benign 0.00
R0879:Zfp292 UTSW 4 34,811,218 (GRCm39) missense probably benign 0.00
R1083:Zfp292 UTSW 4 34,807,569 (GRCm39) missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34,805,238 (GRCm39) missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34,805,397 (GRCm39) missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34,808,935 (GRCm39) missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34,811,237 (GRCm39) missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34,811,043 (GRCm39) missense probably benign 0.02
R1837:Zfp292 UTSW 4 34,810,264 (GRCm39) missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34,807,452 (GRCm39) missense probably benign 0.22
R2107:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34,810,266 (GRCm39) missense probably benign 0.13
R2182:Zfp292 UTSW 4 34,807,417 (GRCm39) missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34,807,962 (GRCm39) missense probably benign 0.07
R2306:Zfp292 UTSW 4 34,809,468 (GRCm39) missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34,811,281 (GRCm39) missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34,806,426 (GRCm39) missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34,808,814 (GRCm39) missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34,810,326 (GRCm39) missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34,807,744 (GRCm39) missense probably benign 0.00
R4006:Zfp292 UTSW 4 34,809,611 (GRCm39) missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34,806,079 (GRCm39) missense probably benign 0.04
R4641:Zfp292 UTSW 4 34,807,828 (GRCm39) missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34,807,078 (GRCm39) missense probably benign 0.00
R4718:Zfp292 UTSW 4 34,819,521 (GRCm39) missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34,808,917 (GRCm39) missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34,839,878 (GRCm39) missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34,809,755 (GRCm39) missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34,805,842 (GRCm39) missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34,807,491 (GRCm39) missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34,806,261 (GRCm39) missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34,811,703 (GRCm39) missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34,806,747 (GRCm39) missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34,805,125 (GRCm39) missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34,805,464 (GRCm39) missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34,811,902 (GRCm39) missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34,808,497 (GRCm39) missense probably benign 0.13
R6209:Zfp292 UTSW 4 34,809,442 (GRCm39) missense probably benign 0.14
R6275:Zfp292 UTSW 4 34,808,883 (GRCm39) missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34,816,301 (GRCm39) missense probably benign 0.21
R6747:Zfp292 UTSW 4 34,806,894 (GRCm39) missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34,807,812 (GRCm39) missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34,816,357 (GRCm39) missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34,806,796 (GRCm39) missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34,808,679 (GRCm39) missense probably benign
R7254:Zfp292 UTSW 4 34,819,476 (GRCm39) missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34,806,839 (GRCm39) missense probably benign
R7378:Zfp292 UTSW 4 34,808,384 (GRCm39) missense probably benign 0.26
R7535:Zfp292 UTSW 4 34,811,487 (GRCm39) missense probably benign 0.28
R7589:Zfp292 UTSW 4 34,806,777 (GRCm39) missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34,809,865 (GRCm39) missense probably benign 0.02
R7979:Zfp292 UTSW 4 34,809,198 (GRCm39) missense probably benign 0.02
R7997:Zfp292 UTSW 4 34,808,688 (GRCm39) missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34,807,386 (GRCm39) missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34,806,163 (GRCm39) missense probably benign 0.00
R8302:Zfp292 UTSW 4 34,810,893 (GRCm39) missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34,826,691 (GRCm39) critical splice donor site probably null
R8709:Zfp292 UTSW 4 34,805,982 (GRCm39) missense probably damaging 1.00
R8947:Zfp292 UTSW 4 34,811,835 (GRCm39) missense probably damaging 1.00
R9099:Zfp292 UTSW 4 34,809,228 (GRCm39) missense possibly damaging 0.53
R9190:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R9256:Zfp292 UTSW 4 34,839,899 (GRCm39) missense probably benign 0.02
R9371:Zfp292 UTSW 4 34,810,800 (GRCm39) missense probably damaging 1.00
R9492:Zfp292 UTSW 4 34,810,794 (GRCm39) missense probably benign 0.12
R9574:Zfp292 UTSW 4 34,839,460 (GRCm39) missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34,811,058 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTCACTTGTGATGGC -3'
(R):5'- TTTTCTGTACAAAATGAGGCAGGAC -3'

Posted On 2017-07-14