Incidental Mutation 'R6056:Stx18'
ID484386
Institutional Source Beutler Lab
Gene Symbol Stx18
Ensembl Gene ENSMUSG00000029125
Gene Namesyntaxin 18
Synonyms1810035L21Rik, 4933425D03Rik
MMRRC Submission 044223-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6056 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location38038742-38137765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38106564 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 64 (A64D)
Ref Sequence ENSEMBL: ENSMUSP00000118218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031008] [ENSMUST00000042146] [ENSMUST00000114126] [ENSMUST00000146864] [ENSMUST00000154929] [ENSMUST00000202412]
Predicted Effect probably benign
Transcript: ENSMUST00000031008
AA Change: A118D

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031008
Gene: ENSMUSG00000029125
AA Change: A118D

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042146
SMART Domains Protein: ENSMUSP00000038205
Gene: ENSMUSG00000029125

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 170 183 N/A INTRINSIC
coiled coil region 203 233 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114126
AA Change: A118D

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109761
Gene: ENSMUSG00000029125
AA Change: A118D

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 3.4e-24 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146864
AA Change: A37D

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143909
Gene: ENSMUSG00000029125
AA Change: A37D

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
coiled coil region 148 178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154929
AA Change: A64D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118218
Gene: ENSMUSG00000029125
AA Change: A64D

DomainStartEndE-ValueType
low complexity region 142 155 N/A INTRINSIC
coiled coil region 175 205 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201285
Predicted Effect probably benign
Transcript: ENSMUST00000202412
Meta Mutation Damage Score 0.1848 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin family of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) which is part of a membrane tethering complex that includes other SNAREs and several peripheral membrane proteins, and is involved in vesicular transport between the endoplasmic reticulum (ER) and the Golgi complex. The encoded protein is important for the organization of the smooth, rough, and exit site ER subdomains. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,878 W162R probably benign Het
2610507B11Rik C A 11: 78,271,384 L691I possibly damaging Het
4930438A08Rik C A 11: 58,293,638 P394H probably damaging Het
Aggf1 C T 13: 95,371,615 C81Y probably benign Het
Agxt2 A T 15: 10,378,877 D188V probably damaging Het
Angpt2 T C 8: 18,698,116 K376R probably benign Het
Anxa5 A G 3: 36,450,691 S241P probably damaging Het
Aox3 A T 1: 58,169,859 K850N probably damaging Het
Arid5a T C 1: 36,319,392 M415T probably benign Het
Aspa T A 11: 73,308,752 N233I probably damaging Het
Atp4b C T 8: 13,388,782 R198Q probably damaging Het
Atp8b2 A T 3: 89,946,221 V719E possibly damaging Het
Cacna1s T G 1: 136,105,836 V1017G probably damaging Het
Chrna4 G T 2: 181,029,442 Q174K probably damaging Het
Chrnb1 A T 11: 69,786,939 V329D probably damaging Het
Chst14 T C 2: 118,927,733 L336P probably damaging Het
Clec2e T C 6: 129,100,809 D22G probably benign Het
Csrnp2 A C 15: 100,482,382 S343A probably benign Het
Dapl1 C A 2: 59,484,713 A2E probably damaging Het
Dlec1 G T 9: 119,121,923 R519L probably damaging Het
Dmgdh T A 13: 93,708,743 F415I possibly damaging Het
Dmgdh T C 13: 93,752,326 V824A probably damaging Het
Dnah11 T G 12: 117,928,456 T3661P probably benign Het
Dnah3 A G 7: 120,030,031 F1434L probably damaging Het
Dnajc11 C A 4: 151,978,126 probably benign Het
Dot1l A G 10: 80,786,095 E527G probably damaging Het
Drc7 T C 8: 95,075,051 L680P probably damaging Het
Dysf T C 6: 84,106,862 Y742H probably benign Het
Ece1 A G 4: 137,961,647 Y665C probably damaging Het
Emc1 A G 4: 139,354,222 K54E possibly damaging Het
Enoph1 C T 5: 100,067,901 T247M probably damaging Het
Exoc2 T C 13: 30,900,829 K383R probably benign Het
Fam227b A T 2: 126,121,052 H181Q probably damaging Het
Fsip2 A T 2: 82,985,673 M3917L probably benign Het
Gtf3a T A 5: 146,955,528 probably benign Het
Hgfac T A 5: 35,041,629 C11* probably null Het
Hmcn1 C A 1: 150,663,909 A2944S probably damaging Het
Hps5 T A 7: 46,767,097 Y947F probably benign Het
Ighv2-5 A T 12: 113,685,500 I111K probably benign Het
Inpp5e A T 2: 26,407,848 L247* probably null Het
Kbtbd11 T C 8: 15,027,577 S59P probably benign Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kif1a T C 1: 93,024,648 D1303G probably damaging Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Lrit3 A T 3: 129,789,355 C328S probably damaging Het
Lrrc37a G T 11: 103,497,658 Q2314K unknown Het
Lurap1 G T 4: 116,137,402 P211T possibly damaging Het
Mbd2 T A 18: 70,580,803 N5K possibly damaging Het
Mbtps1 A C 8: 119,515,602 L894V probably benign Het
Mefv G A 16: 3,708,042 S787F possibly damaging Het
Miip T A 4: 147,862,335 I289F probably damaging Het
Mogat2 T A 7: 99,223,513 I155F possibly damaging Het
Mpp3 C A 11: 102,011,689 probably null Het
Mrrf A G 2: 36,177,221 K220E probably damaging Het
Mtmr6 C T 14: 60,298,170 P485L probably damaging Het
Mtor G A 4: 148,537,435 R1896K probably benign Het
Myh3 C T 11: 67,087,545 P453S probably benign Het
Nebl A G 2: 17,450,234 V112A probably benign Het
Nmnat2 G A 1: 153,074,734 W55* probably null Het
Nprl3 A G 11: 32,267,432 S37P probably damaging Het
Olfr1246 T C 2: 89,591,101 N5D possibly damaging Het
Oraov1 G T 7: 144,915,286 V17L possibly damaging Het
Pcdhga4 T G 18: 37,686,330 S311A probably benign Het
Pcdhgb6 T C 18: 37,743,112 V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg3 T C 7: 6,709,571 E884G probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Phf12 A G 11: 78,009,515 T146A probably benign Het
Polr3k C G 2: 181,864,488 N10K probably damaging Het
Prickle4 C A 17: 47,690,210 G144C probably damaging Het
Ptpn6 T C 6: 124,732,435 Y25C probably damaging Het
Rad1 A G 15: 10,488,074 I95V probably damaging Het
Rad23b A G 4: 55,382,540 T248A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rcc2 T G 4: 140,717,024 V342G possibly damaging Het
Rgs3 G T 4: 62,625,906 R136L probably damaging Het
Scube2 A T 7: 109,833,013 C399* probably null Het
Serpinb3d T C 1: 107,079,722 Y178C probably damaging Het
Slc1a7 A G 4: 108,012,261 T508A probably benign Het
Slc29a4 C T 5: 142,720,077 R439C probably damaging Het
Sntg2 A G 12: 30,312,561 I62T probably benign Het
Sowaha G A 11: 53,479,087 P274L probably damaging Het
Sptan1 A G 2: 29,996,782 N869S probably benign Het
Stxbp5 A G 10: 9,770,686 V94A probably benign Het
Sult1a1 T A 7: 126,676,452 probably null Het
Susd1 G T 4: 59,379,687 H313Q possibly damaging Het
Tdrd9 A T 12: 111,985,041 K88N probably damaging Het
Tlr5 A C 1: 182,974,038 R302S possibly damaging Het
Tnr C T 1: 159,886,909 T786I probably damaging Het
Tprgl A G 4: 154,160,095 S148P probably damaging Het
Trpc4ap T A 2: 155,671,074 N127I probably damaging Het
Tulp2 T A 7: 45,490,373 probably null Het
Uggt2 C T 14: 119,035,969 probably null Het
Ulk4 T A 9: 121,272,955 Y19F probably damaging Het
Upf1 T C 8: 70,333,037 Y1053C probably damaging Het
Vars2 A T 17: 35,665,788 H223Q probably benign Het
Vmn2r106 T A 17: 20,267,544 probably null Het
Ythdc2 T A 18: 44,840,210 F305I probably damaging Het
Zfp281 T C 1: 136,625,440 F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp335 A T 2: 164,895,098 probably null Het
Other mutations in Stx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Stx18 APN 5 38106611 missense possibly damaging 0.86
IGL02123:Stx18 APN 5 38128103 missense probably damaging 1.00
IGL03107:Stx18 APN 5 38136311 missense probably damaging 1.00
IGL03187:Stx18 APN 5 38126983 missense possibly damaging 0.94
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0414:Stx18 UTSW 5 38105005 splice site probably benign
R0713:Stx18 UTSW 5 38106671 intron probably null
R1147:Stx18 UTSW 5 38126923 splice site probably benign
R1552:Stx18 UTSW 5 38104991 missense probably damaging 0.99
R1725:Stx18 UTSW 5 38135255 missense probably damaging 1.00
R1929:Stx18 UTSW 5 38128039 splice site probably null
R2020:Stx18 UTSW 5 38135244 missense probably damaging 1.00
R4678:Stx18 UTSW 5 38136368 unclassified probably benign
R5247:Stx18 UTSW 5 38106633 missense probably damaging 1.00
R6330:Stx18 UTSW 5 38126917 unclassified probably null
R6860:Stx18 UTSW 5 38104891 missense possibly damaging 0.62
R7060:Stx18 UTSW 5 38121255 missense possibly damaging 0.87
R7285:Stx18 UTSW 5 38104907 missense possibly damaging 0.91
R7351:Stx18 UTSW 5 38039411 missense probably benign 0.00
X0026:Stx18 UTSW 5 38104966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAGCCAGGTCAGCATTC -3'
(R):5'- TGAGACACTATGGTCTTCAGC -3'

Posted On2017-07-14