Incidental Mutation 'R6056:Scube2'
ID 484398
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703B1614Q5.1, Cegf1, ICRFP703N2430Q5.1, 4932442O19Rik
MMRRC Submission 044223-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.633) question?
Stock # R6056 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109397897-109464886 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 109432220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 399 (C399*)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably null
Transcript: ENSMUST00000007423
AA Change: C399*
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: C399*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106728
AA Change: C399*
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: C399*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000106729
AA Change: C399*
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: C399*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,115 (GRCm39) W162R probably benign Het
4930438A08Rik C A 11: 58,184,464 (GRCm39) P394H probably damaging Het
Aggf1 C T 13: 95,508,123 (GRCm39) C81Y probably benign Het
Agxt2 A T 15: 10,378,963 (GRCm39) D188V probably damaging Het
Angpt2 T C 8: 18,748,132 (GRCm39) K376R probably benign Het
Anxa5 A G 3: 36,504,840 (GRCm39) S241P probably damaging Het
Aox3 A T 1: 58,209,018 (GRCm39) K850N probably damaging Het
Arid5a T C 1: 36,358,473 (GRCm39) M415T probably benign Het
Aspa T A 11: 73,199,578 (GRCm39) N233I probably damaging Het
Atp4b C T 8: 13,438,782 (GRCm39) R198Q probably damaging Het
Atp8b2 A T 3: 89,853,528 (GRCm39) V719E possibly damaging Het
Bltp2 C A 11: 78,162,210 (GRCm39) L691I possibly damaging Het
Cacna1s T G 1: 136,033,574 (GRCm39) V1017G probably damaging Het
Chrna4 G T 2: 180,671,235 (GRCm39) Q174K probably damaging Het
Chrnb1 A T 11: 69,677,765 (GRCm39) V329D probably damaging Het
Chst14 T C 2: 118,758,214 (GRCm39) L336P probably damaging Het
Clec2e T C 6: 129,077,772 (GRCm39) D22G probably benign Het
Csrnp2 A C 15: 100,380,263 (GRCm39) S343A probably benign Het
Dapl1 C A 2: 59,315,057 (GRCm39) A2E probably damaging Het
Dlec1 G T 9: 118,950,991 (GRCm39) R519L probably damaging Het
Dmgdh T A 13: 93,845,251 (GRCm39) F415I possibly damaging Het
Dmgdh T C 13: 93,888,834 (GRCm39) V824A probably damaging Het
Dnah11 T G 12: 117,892,191 (GRCm39) T3661P probably benign Het
Dnah3 A G 7: 119,629,254 (GRCm39) F1434L probably damaging Het
Dnajc11 C A 4: 152,062,583 (GRCm39) probably benign Het
Dot1l A G 10: 80,621,929 (GRCm39) E527G probably damaging Het
Drc7 T C 8: 95,801,679 (GRCm39) L680P probably damaging Het
Dysf T C 6: 84,083,844 (GRCm39) Y742H probably benign Het
Ece1 A G 4: 137,688,958 (GRCm39) Y665C probably damaging Het
Emc1 A G 4: 139,081,533 (GRCm39) K54E possibly damaging Het
Enoph1 C T 5: 100,215,760 (GRCm39) T247M probably damaging Het
Exoc2 T C 13: 31,084,812 (GRCm39) K383R probably benign Het
Fam227b A T 2: 125,962,972 (GRCm39) H181Q probably damaging Het
Fsip2 A T 2: 82,816,017 (GRCm39) M3917L probably benign Het
Gtf3a T A 5: 146,892,338 (GRCm39) probably benign Het
Hgfac T A 5: 35,198,973 (GRCm39) C11* probably null Het
Hmcn1 C A 1: 150,539,660 (GRCm39) A2944S probably damaging Het
Hps5 T A 7: 46,416,521 (GRCm39) Y947F probably benign Het
Ighv2-5 A T 12: 113,649,120 (GRCm39) I111K probably benign Het
Inpp5e A T 2: 26,297,860 (GRCm39) L247* probably null Het
Kbtbd11 T C 8: 15,077,577 (GRCm39) S59P probably benign Het
Kctd19 G A 8: 106,123,082 (GRCm39) H111Y probably damaging Het
Kif1a T C 1: 92,952,370 (GRCm39) D1303G probably damaging Het
Kif7 A G 7: 79,363,842 (GRCm39) V22A possibly damaging Het
Lrit3 A T 3: 129,583,004 (GRCm39) C328S probably damaging Het
Lrrc37a G T 11: 103,388,484 (GRCm39) Q2314K unknown Het
LTO1 G T 7: 144,469,023 (GRCm39) V17L possibly damaging Het
Lurap1 G T 4: 115,994,599 (GRCm39) P211T possibly damaging Het
Mbd2 T A 18: 70,713,874 (GRCm39) N5K possibly damaging Het
Mbtps1 A C 8: 120,242,341 (GRCm39) L894V probably benign Het
Mefv G A 16: 3,525,906 (GRCm39) S787F possibly damaging Het
Miip T A 4: 147,946,792 (GRCm39) I289F probably damaging Het
Mogat2 T A 7: 98,872,720 (GRCm39) I155F possibly damaging Het
Mpp3 C A 11: 101,902,515 (GRCm39) probably null Het
Mrrf A G 2: 36,067,233 (GRCm39) K220E probably damaging Het
Mtmr6 C T 14: 60,535,619 (GRCm39) P485L probably damaging Het
Mtor G A 4: 148,621,892 (GRCm39) R1896K probably benign Het
Myh3 C T 11: 66,978,371 (GRCm39) P453S probably benign Het
Nebl A G 2: 17,455,045 (GRCm39) V112A probably benign Het
Nmnat2 G A 1: 152,950,480 (GRCm39) W55* probably null Het
Nprl3 A G 11: 32,217,432 (GRCm39) S37P probably damaging Het
Or4a73 T C 2: 89,421,445 (GRCm39) N5D possibly damaging Het
Pcdhga4 T G 18: 37,819,383 (GRCm39) S311A probably benign Het
Pcdhgb6 T C 18: 37,876,165 (GRCm39) V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Peg3 T C 7: 6,712,570 (GRCm39) E884G probably damaging Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Phf12 A G 11: 77,900,341 (GRCm39) T146A probably benign Het
Polr3k C G 2: 181,506,281 (GRCm39) N10K probably damaging Het
Prickle4 C A 17: 48,001,135 (GRCm39) G144C probably damaging Het
Ptpn6 T C 6: 124,709,398 (GRCm39) Y25C probably damaging Het
Rad1 A G 15: 10,488,160 (GRCm39) I95V probably damaging Het
Rad23b A G 4: 55,382,540 (GRCm39) T248A probably benign Het
Rapgef3 T C 15: 97,656,742 (GRCm39) D299G probably damaging Het
Rcc2 T G 4: 140,444,335 (GRCm39) V342G possibly damaging Het
Rgs3 G T 4: 62,544,143 (GRCm39) R136L probably damaging Het
Serpinb3d T C 1: 107,007,452 (GRCm39) Y178C probably damaging Het
Slc1a7 A G 4: 107,869,458 (GRCm39) T508A probably benign Het
Slc29a4 C T 5: 142,705,832 (GRCm39) R439C probably damaging Het
Sntg2 A G 12: 30,362,560 (GRCm39) I62T probably benign Het
Sowaha G A 11: 53,369,914 (GRCm39) P274L probably damaging Het
Sptan1 A G 2: 29,886,794 (GRCm39) N869S probably benign Het
Stx18 C A 5: 38,263,908 (GRCm39) A64D probably damaging Het
Stxbp5 A G 10: 9,646,430 (GRCm39) V94A probably benign Het
Sult1a1 T A 7: 126,275,624 (GRCm39) probably null Het
Susd1 G T 4: 59,379,687 (GRCm39) H313Q possibly damaging Het
Tdrd9 A T 12: 111,951,475 (GRCm39) K88N probably damaging Het
Tlr5 A C 1: 182,801,603 (GRCm39) R302S possibly damaging Het
Tnr C T 1: 159,714,479 (GRCm39) T786I probably damaging Het
Tprg1l A G 4: 154,244,552 (GRCm39) S148P probably damaging Het
Trpc4ap T A 2: 155,512,994 (GRCm39) N127I probably damaging Het
Tulp2 T A 7: 45,139,797 (GRCm39) probably null Het
Uggt2 C T 14: 119,273,381 (GRCm39) probably null Het
Ulk4 T A 9: 121,102,021 (GRCm39) Y19F probably damaging Het
Upf1 T C 8: 70,785,687 (GRCm39) Y1053C probably damaging Het
Vars2 A T 17: 35,976,680 (GRCm39) H223Q probably benign Het
Vmn2r106 T A 17: 20,487,806 (GRCm39) probably null Het
Ythdc2 T A 18: 44,973,277 (GRCm39) F305I probably damaging Het
Zfp281 T C 1: 136,553,178 (GRCm39) F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 (GRCm39) C1087S probably damaging Het
Zfp335 A T 2: 164,737,018 (GRCm39) probably null Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109,407,661 (GRCm39) missense probably damaging 1.00
IGL01608:Scube2 APN 7 109,442,461 (GRCm39) missense probably benign
IGL02080:Scube2 APN 7 109,451,685 (GRCm39) missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109,408,387 (GRCm39) missense probably benign 0.22
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0106:Scube2 UTSW 7 109,446,115 (GRCm39) splice site probably benign
R0230:Scube2 UTSW 7 109,423,971 (GRCm39) critical splice donor site probably null
R0255:Scube2 UTSW 7 109,424,079 (GRCm39) missense probably damaging 0.98
R0427:Scube2 UTSW 7 109,424,044 (GRCm39) missense probably benign 0.00
R0612:Scube2 UTSW 7 109,403,971 (GRCm39) splice site probably benign
R0658:Scube2 UTSW 7 109,436,327 (GRCm39) splice site probably benign
R0687:Scube2 UTSW 7 109,428,335 (GRCm39) missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1366:Scube2 UTSW 7 109,403,821 (GRCm39) missense probably damaging 1.00
R1635:Scube2 UTSW 7 109,442,421 (GRCm39) missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1972:Scube2 UTSW 7 109,408,421 (GRCm39) missense probably benign 0.16
R2080:Scube2 UTSW 7 109,407,712 (GRCm39) missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109,424,666 (GRCm39) missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109,403,908 (GRCm39) missense probably damaging 1.00
R2325:Scube2 UTSW 7 109,443,161 (GRCm39) missense probably damaging 1.00
R3723:Scube2 UTSW 7 109,407,613 (GRCm39) splice site probably benign
R3887:Scube2 UTSW 7 109,442,383 (GRCm39) splice site probably benign
R3946:Scube2 UTSW 7 109,456,797 (GRCm39) missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109,430,978 (GRCm39) missense probably benign 0.09
R4621:Scube2 UTSW 7 109,399,857 (GRCm39) missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109,409,920 (GRCm39) missense probably damaging 0.96
R4736:Scube2 UTSW 7 109,430,412 (GRCm39) missense probably benign 0.01
R5096:Scube2 UTSW 7 109,398,451 (GRCm39) utr 3 prime probably benign
R5266:Scube2 UTSW 7 109,408,437 (GRCm39) missense probably damaging 1.00
R5579:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R5669:Scube2 UTSW 7 109,424,646 (GRCm39) missense probably benign 0.04
R5838:Scube2 UTSW 7 109,407,651 (GRCm39) missense probably damaging 1.00
R5916:Scube2 UTSW 7 109,430,931 (GRCm39) missense possibly damaging 0.77
R6731:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R6785:Scube2 UTSW 7 109,409,824 (GRCm39) missense probably benign
R8197:Scube2 UTSW 7 109,407,684 (GRCm39) missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109,463,377 (GRCm39) missense probably benign 0.20
R8273:Scube2 UTSW 7 109,408,383 (GRCm39) missense probably benign 0.00
R8427:Scube2 UTSW 7 109,399,797 (GRCm39) missense probably damaging 1.00
R8882:Scube2 UTSW 7 109,451,680 (GRCm39) missense probably damaging 1.00
R9258:Scube2 UTSW 7 109,398,515 (GRCm39) missense probably damaging 1.00
R9428:Scube2 UTSW 7 109,428,345 (GRCm39) missense probably benign 0.32
R9476:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9510:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9709:Scube2 UTSW 7 109,430,971 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,442,408 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,437,334 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCTCAGTTCTTCTGTACTC -3'
(R):5'- GGCTATTGGTCAGCAACTTGC -3'

Posted On 2017-07-14