Incidental Mutation 'R6056:Upf1'
ID484404
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene NameUPF1 regulator of nonsense transcripts homolog (yeast)
SynonymsB430202H16Rik, PNORF-1, Rent1
MMRRC Submission 044223-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6056 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70331525-70353278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70333037 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1053 (Y1053C)
Ref Sequence ENSEMBL: ENSMUSP00000148927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
Predicted Effect probably damaging
Transcript: ENSMUST00000075666
AA Change: Y1064C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: Y1064C

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207684
Predicted Effect probably damaging
Transcript: ENSMUST00000215817
AA Change: Y1053C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,878 W162R probably benign Het
2610507B11Rik C A 11: 78,271,384 L691I possibly damaging Het
4930438A08Rik C A 11: 58,293,638 P394H probably damaging Het
Aggf1 C T 13: 95,371,615 C81Y probably benign Het
Agxt2 A T 15: 10,378,877 D188V probably damaging Het
Angpt2 T C 8: 18,698,116 K376R probably benign Het
Anxa5 A G 3: 36,450,691 S241P probably damaging Het
Aox3 A T 1: 58,169,859 K850N probably damaging Het
Arid5a T C 1: 36,319,392 M415T probably benign Het
Aspa T A 11: 73,308,752 N233I probably damaging Het
Atp4b C T 8: 13,388,782 R198Q probably damaging Het
Atp8b2 A T 3: 89,946,221 V719E possibly damaging Het
Cacna1s T G 1: 136,105,836 V1017G probably damaging Het
Chrna4 G T 2: 181,029,442 Q174K probably damaging Het
Chrnb1 A T 11: 69,786,939 V329D probably damaging Het
Chst14 T C 2: 118,927,733 L336P probably damaging Het
Clec2e T C 6: 129,100,809 D22G probably benign Het
Csrnp2 A C 15: 100,482,382 S343A probably benign Het
Dapl1 C A 2: 59,484,713 A2E probably damaging Het
Dlec1 G T 9: 119,121,923 R519L probably damaging Het
Dmgdh T A 13: 93,708,743 F415I possibly damaging Het
Dmgdh T C 13: 93,752,326 V824A probably damaging Het
Dnah11 T G 12: 117,928,456 T3661P probably benign Het
Dnah3 A G 7: 120,030,031 F1434L probably damaging Het
Dnajc11 C A 4: 151,978,126 probably benign Het
Dot1l A G 10: 80,786,095 E527G probably damaging Het
Drc7 T C 8: 95,075,051 L680P probably damaging Het
Dysf T C 6: 84,106,862 Y742H probably benign Het
Ece1 A G 4: 137,961,647 Y665C probably damaging Het
Emc1 A G 4: 139,354,222 K54E possibly damaging Het
Enoph1 C T 5: 100,067,901 T247M probably damaging Het
Exoc2 T C 13: 30,900,829 K383R probably benign Het
Fam227b A T 2: 126,121,052 H181Q probably damaging Het
Fsip2 A T 2: 82,985,673 M3917L probably benign Het
Gtf3a T A 5: 146,955,528 probably benign Het
Hgfac T A 5: 35,041,629 C11* probably null Het
Hmcn1 C A 1: 150,663,909 A2944S probably damaging Het
Hps5 T A 7: 46,767,097 Y947F probably benign Het
Ighv2-5 A T 12: 113,685,500 I111K probably benign Het
Inpp5e A T 2: 26,407,848 L247* probably null Het
Kbtbd11 T C 8: 15,027,577 S59P probably benign Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kif1a T C 1: 93,024,648 D1303G probably damaging Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Lrit3 A T 3: 129,789,355 C328S probably damaging Het
Lrrc37a G T 11: 103,497,658 Q2314K unknown Het
Lurap1 G T 4: 116,137,402 P211T possibly damaging Het
Mbd2 T A 18: 70,580,803 N5K possibly damaging Het
Mbtps1 A C 8: 119,515,602 L894V probably benign Het
Mefv G A 16: 3,708,042 S787F possibly damaging Het
Miip T A 4: 147,862,335 I289F probably damaging Het
Mogat2 T A 7: 99,223,513 I155F possibly damaging Het
Mpp3 C A 11: 102,011,689 probably null Het
Mrrf A G 2: 36,177,221 K220E probably damaging Het
Mtmr6 C T 14: 60,298,170 P485L probably damaging Het
Mtor G A 4: 148,537,435 R1896K probably benign Het
Myh3 C T 11: 67,087,545 P453S probably benign Het
Nebl A G 2: 17,450,234 V112A probably benign Het
Nmnat2 G A 1: 153,074,734 W55* probably null Het
Nprl3 A G 11: 32,267,432 S37P probably damaging Het
Olfr1246 T C 2: 89,591,101 N5D possibly damaging Het
Oraov1 G T 7: 144,915,286 V17L possibly damaging Het
Pcdhga4 T G 18: 37,686,330 S311A probably benign Het
Pcdhgb6 T C 18: 37,743,112 V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg3 T C 7: 6,709,571 E884G probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Phf12 A G 11: 78,009,515 T146A probably benign Het
Polr3k C G 2: 181,864,488 N10K probably damaging Het
Prickle4 C A 17: 47,690,210 G144C probably damaging Het
Ptpn6 T C 6: 124,732,435 Y25C probably damaging Het
Rad1 A G 15: 10,488,074 I95V probably damaging Het
Rad23b A G 4: 55,382,540 T248A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rcc2 T G 4: 140,717,024 V342G possibly damaging Het
Rgs3 G T 4: 62,625,906 R136L probably damaging Het
Scube2 A T 7: 109,833,013 C399* probably null Het
Serpinb3d T C 1: 107,079,722 Y178C probably damaging Het
Slc1a7 A G 4: 108,012,261 T508A probably benign Het
Slc29a4 C T 5: 142,720,077 R439C probably damaging Het
Sntg2 A G 12: 30,312,561 I62T probably benign Het
Sowaha G A 11: 53,479,087 P274L probably damaging Het
Sptan1 A G 2: 29,996,782 N869S probably benign Het
Stx18 C A 5: 38,106,564 A64D probably damaging Het
Stxbp5 A G 10: 9,770,686 V94A probably benign Het
Sult1a1 T A 7: 126,676,452 probably null Het
Susd1 G T 4: 59,379,687 H313Q possibly damaging Het
Tdrd9 A T 12: 111,985,041 K88N probably damaging Het
Tlr5 A C 1: 182,974,038 R302S possibly damaging Het
Tnr C T 1: 159,886,909 T786I probably damaging Het
Tprgl A G 4: 154,160,095 S148P probably damaging Het
Trpc4ap T A 2: 155,671,074 N127I probably damaging Het
Tulp2 T A 7: 45,490,373 probably null Het
Uggt2 C T 14: 119,035,969 probably null Het
Ulk4 T A 9: 121,272,955 Y19F probably damaging Het
Vars2 A T 17: 35,665,788 H223Q probably benign Het
Vmn2r106 T A 17: 20,267,544 probably null Het
Ythdc2 T A 18: 44,840,210 F305I probably damaging Het
Zfp281 T C 1: 136,625,440 F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp335 A T 2: 164,895,098 probably null Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70338284 missense probably benign
IGL01890:Upf1 APN 8 70334230 missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70335652 critical splice donor site probably null
IGL03142:Upf1 APN 8 70333327 missense probably benign 0.04
IGL03151:Upf1 APN 8 70335387 missense probably damaging 0.98
Nanosphere UTSW 8 70344262 missense probably benign 0.01
Particulate UTSW 8 70337025 missense probably damaging 0.96
R0270:Upf1 UTSW 8 70335645 splice site probably benign
R0477:Upf1 UTSW 8 70334080 missense probably benign
R0755:Upf1 UTSW 8 70334129 missense probably benign 0.01
R1018:Upf1 UTSW 8 70338906 missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70338403 missense probably damaging 0.98
R1445:Upf1 UTSW 8 70341524 missense probably benign 0.00
R1458:Upf1 UTSW 8 70344254 missense probably benign 0.00
R1511:Upf1 UTSW 8 70338505 missense probably damaging 0.99
R1552:Upf1 UTSW 8 70333059 nonsense probably null
R1560:Upf1 UTSW 8 70338442 missense probably damaging 1.00
R1562:Upf1 UTSW 8 70343367 nonsense probably null
R2082:Upf1 UTSW 8 70341572 missense probably damaging 1.00
R2143:Upf1 UTSW 8 70339354 missense probably null 1.00
R2423:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R2425:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3031:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3032:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3123:Upf1 UTSW 8 70337483 splice site probably benign
R3508:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3747:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70339814 missense probably benign 0.30
R3964:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3965:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4152:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4505:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4506:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4838:Upf1 UTSW 8 70339368 missense probably benign 0.03
R5001:Upf1 UTSW 8 70334700 missense probably damaging 1.00
R5715:Upf1 UTSW 8 70352978 missense probably damaging 0.96
R5748:Upf1 UTSW 8 70338517 missense probably damaging 1.00
R5856:Upf1 UTSW 8 70334762 critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70344262 missense probably benign 0.01
R6010:Upf1 UTSW 8 70337025 missense probably damaging 0.96
R6870:Upf1 UTSW 8 70341561 missense probably benign 0.11
R7205:Upf1 UTSW 8 70340045 missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70340618 missense probably damaging 1.00
R7464:Upf1 UTSW 8 70333423 missense probably benign
R7759:Upf1 UTSW 8 70334080 missense probably benign
R7783:Upf1 UTSW 8 70352858 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGGAAGAAACCCCATACTGC -3'
(R):5'- CCTAGCTTTAGGTAGACCTTGC -3'

Posted On2017-07-14