Incidental Mutation 'R6056:Mbtps1'
ID484408
Institutional Source Beutler Lab
Gene Symbol Mbtps1
Ensembl Gene ENSMUSG00000031835
Gene Namemembrane-bound transcription factor peptidase, site 1
Synonymssubtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik
MMRRC Submission 044223-MU
Accession Numbers

ENSMUST00000098362; MGI: 1927235

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6056 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location119508156-119558735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119515602 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 894 (L894V)
Ref Sequence ENSEMBL: ENSMUSP00000095965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]
Predicted Effect probably benign
Transcript: ENSMUST00000081381
AA Change: L894V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: L894V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 209 464 1.5e-43 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098362
AA Change: L894V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: L894V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 213 473 3.7e-45 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212736
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,878 W162R probably benign Het
2610507B11Rik C A 11: 78,271,384 L691I possibly damaging Het
4930438A08Rik C A 11: 58,293,638 P394H probably damaging Het
Aggf1 C T 13: 95,371,615 C81Y probably benign Het
Agxt2 A T 15: 10,378,877 D188V probably damaging Het
Angpt2 T C 8: 18,698,116 K376R probably benign Het
Anxa5 A G 3: 36,450,691 S241P probably damaging Het
Aox3 A T 1: 58,169,859 K850N probably damaging Het
Arid5a T C 1: 36,319,392 M415T probably benign Het
Aspa T A 11: 73,308,752 N233I probably damaging Het
Atp4b C T 8: 13,388,782 R198Q probably damaging Het
Atp8b2 A T 3: 89,946,221 V719E possibly damaging Het
Cacna1s T G 1: 136,105,836 V1017G probably damaging Het
Chrna4 G T 2: 181,029,442 Q174K probably damaging Het
Chrnb1 A T 11: 69,786,939 V329D probably damaging Het
Chst14 T C 2: 118,927,733 L336P probably damaging Het
Clec2e T C 6: 129,100,809 D22G probably benign Het
Csrnp2 A C 15: 100,482,382 S343A probably benign Het
Dapl1 C A 2: 59,484,713 A2E probably damaging Het
Dlec1 G T 9: 119,121,923 R519L probably damaging Het
Dmgdh T A 13: 93,708,743 F415I possibly damaging Het
Dmgdh T C 13: 93,752,326 V824A probably damaging Het
Dnah11 T G 12: 117,928,456 T3661P probably benign Het
Dnah3 A G 7: 120,030,031 F1434L probably damaging Het
Dnajc11 C A 4: 151,978,126 probably benign Het
Dot1l A G 10: 80,786,095 E527G probably damaging Het
Drc7 T C 8: 95,075,051 L680P probably damaging Het
Dysf T C 6: 84,106,862 Y742H probably benign Het
Ece1 A G 4: 137,961,647 Y665C probably damaging Het
Emc1 A G 4: 139,354,222 K54E possibly damaging Het
Enoph1 C T 5: 100,067,901 T247M probably damaging Het
Exoc2 T C 13: 30,900,829 K383R probably benign Het
Fam227b A T 2: 126,121,052 H181Q probably damaging Het
Fsip2 A T 2: 82,985,673 M3917L probably benign Het
Gtf3a T A 5: 146,955,528 probably benign Het
Hgfac T A 5: 35,041,629 C11* probably null Het
Hmcn1 C A 1: 150,663,909 A2944S probably damaging Het
Hps5 T A 7: 46,767,097 Y947F probably benign Het
Ighv2-5 A T 12: 113,685,500 I111K probably benign Het
Inpp5e A T 2: 26,407,848 L247* probably null Het
Kbtbd11 T C 8: 15,027,577 S59P probably benign Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kif1a T C 1: 93,024,648 D1303G probably damaging Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Lrit3 A T 3: 129,789,355 C328S probably damaging Het
Lrrc37a G T 11: 103,497,658 Q2314K unknown Het
Lurap1 G T 4: 116,137,402 P211T possibly damaging Het
Mbd2 T A 18: 70,580,803 N5K possibly damaging Het
Mefv G A 16: 3,708,042 S787F possibly damaging Het
Miip T A 4: 147,862,335 I289F probably damaging Het
Mogat2 T A 7: 99,223,513 I155F possibly damaging Het
Mpp3 C A 11: 102,011,689 probably null Het
Mrrf A G 2: 36,177,221 K220E probably damaging Het
Mtmr6 C T 14: 60,298,170 P485L probably damaging Het
Mtor G A 4: 148,537,435 R1896K probably benign Het
Myh3 C T 11: 67,087,545 P453S probably benign Het
Nebl A G 2: 17,450,234 V112A probably benign Het
Nmnat2 G A 1: 153,074,734 W55* probably null Het
Nprl3 A G 11: 32,267,432 S37P probably damaging Het
Olfr1246 T C 2: 89,591,101 N5D possibly damaging Het
Oraov1 G T 7: 144,915,286 V17L possibly damaging Het
Pcdhga4 T G 18: 37,686,330 S311A probably benign Het
Pcdhgb6 T C 18: 37,743,112 V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg3 T C 7: 6,709,571 E884G probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Phf12 A G 11: 78,009,515 T146A probably benign Het
Polr3k C G 2: 181,864,488 N10K probably damaging Het
Prickle4 C A 17: 47,690,210 G144C probably damaging Het
Ptpn6 T C 6: 124,732,435 Y25C probably damaging Het
Rad1 A G 15: 10,488,074 I95V probably damaging Het
Rad23b A G 4: 55,382,540 T248A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rcc2 T G 4: 140,717,024 V342G possibly damaging Het
Rgs3 G T 4: 62,625,906 R136L probably damaging Het
Scube2 A T 7: 109,833,013 C399* probably null Het
Serpinb3d T C 1: 107,079,722 Y178C probably damaging Het
Slc1a7 A G 4: 108,012,261 T508A probably benign Het
Slc29a4 C T 5: 142,720,077 R439C probably damaging Het
Sntg2 A G 12: 30,312,561 I62T probably benign Het
Sowaha G A 11: 53,479,087 P274L probably damaging Het
Sptan1 A G 2: 29,996,782 N869S probably benign Het
Stx18 C A 5: 38,106,564 A64D probably damaging Het
Stxbp5 A G 10: 9,770,686 V94A probably benign Het
Sult1a1 T A 7: 126,676,452 probably null Het
Susd1 G T 4: 59,379,687 H313Q possibly damaging Het
Tdrd9 A T 12: 111,985,041 K88N probably damaging Het
Tlr5 A C 1: 182,974,038 R302S possibly damaging Het
Tnr C T 1: 159,886,909 T786I probably damaging Het
Tprgl A G 4: 154,160,095 S148P probably damaging Het
Trpc4ap T A 2: 155,671,074 N127I probably damaging Het
Tulp2 T A 7: 45,490,373 probably null Het
Uggt2 C T 14: 119,035,969 probably null Het
Ulk4 T A 9: 121,272,955 Y19F probably damaging Het
Upf1 T C 8: 70,333,037 Y1053C probably damaging Het
Vars2 A T 17: 35,665,788 H223Q probably benign Het
Vmn2r106 T A 17: 20,267,544 probably null Het
Ythdc2 T A 18: 44,840,210 F305I probably damaging Het
Zfp281 T C 1: 136,625,440 F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp335 A T 2: 164,895,098 probably null Het
Other mutations in Mbtps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
muskrat UTSW 8 119538137 missense probably damaging 1.00
packrat UTSW 8 119528961 missense probably damaging 1.00
woodrat UTSW 8 119529030 missense probably damaging 1.00
R0194:Mbtps1 UTSW 8 119535369 missense probably damaging 1.00
R0270:Mbtps1 UTSW 8 119538117 splice site probably benign
R0485:Mbtps1 UTSW 8 119522601 splice site probably benign
R1269:Mbtps1 UTSW 8 119520277 missense probably damaging 1.00
R1351:Mbtps1 UTSW 8 119518162 missense possibly damaging 0.95
R1536:Mbtps1 UTSW 8 119546125 missense probably benign 0.01
R1542:Mbtps1 UTSW 8 119546247 splice site probably null
R1543:Mbtps1 UTSW 8 119542069 splice site probably benign
R1580:Mbtps1 UTSW 8 119538900 missense possibly damaging 0.79
R1587:Mbtps1 UTSW 8 119518219 missense probably damaging 0.96
R1715:Mbtps1 UTSW 8 119542730 missense probably benign 0.40
R1845:Mbtps1 UTSW 8 119522493 missense probably benign 0.13
R2147:Mbtps1 UTSW 8 119538859 missense probably benign 0.01
R2157:Mbtps1 UTSW 8 119542727 missense probably benign 0.01
R2416:Mbtps1 UTSW 8 119538917 missense probably damaging 1.00
R2910:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R2911:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R3079:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3079:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R3080:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3080:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R4116:Mbtps1 UTSW 8 119541652 missense probably benign 0.00
R4296:Mbtps1 UTSW 8 119522499 missense possibly damaging 0.95
R4602:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4603:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4610:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4611:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4729:Mbtps1 UTSW 8 119525420 missense probably damaging 1.00
R4868:Mbtps1 UTSW 8 119508928 missense probably benign 0.01
R4893:Mbtps1 UTSW 8 119518193 missense probably damaging 1.00
R4999:Mbtps1 UTSW 8 119533348 missense probably damaging 1.00
R6062:Mbtps1 UTSW 8 119531091 missense possibly damaging 0.94
R6237:Mbtps1 UTSW 8 119528961 missense probably damaging 1.00
R6617:Mbtps1 UTSW 8 119538137 missense probably damaging 1.00
R7215:Mbtps1 UTSW 8 119524568 missense possibly damaging 0.82
R7275:Mbtps1 UTSW 8 119542750 missense probably benign
R7794:Mbtps1 UTSW 8 119538884 missense probably damaging 1.00
RF019:Mbtps1 UTSW 8 119525550 missense probably damaging 1.00
X0017:Mbtps1 UTSW 8 119531124 missense probably damaging 1.00
X0027:Mbtps1 UTSW 8 119522547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCCACAGTCTCTGT -3'
(R):5'- CTAAGCGGCTCACTTCTGAG -3'

Posted On2017-07-14