Mutagenetix > Incidental Mutation

Incidental Mutation 'R6056:Lrrc37a'

484421

Institutional Source

Beutler Lab

Gene Symbol

Lrrc37a

Ensembl Gene

ENSMUSG00000078632

Gene Name

leucine rich repeat containing 37A

Synonyms

LOC237954

MMRRC Submission

044223-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R6056 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103451955-103504597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 103497658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 2314 (Q2314K)

Ref Sequence

ENSEMBL: ENSMUSP00000121903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153273]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000153273
AA Change: Q2314K

SMART Domains

Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: Q2314K

Domain	Start	End	E-Value	Type
Pfam:LRRC37	199	269	2.6e-15	PFAM
low complexity region	313	329	N/A	INTRINSIC
Pfam:LRRC37	363	432	4e-18	PFAM
low complexity region	457	467	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
Pfam:LRRC37	550	619	2.1e-21	PFAM
Pfam:LRRC37	637	704	2.9e-12	PFAM
Pfam:LRRC37	780	851	2.5e-12	PFAM
Pfam:LRRC37	1078	1148	2.7e-18	PFAM
Pfam:LRRC37	1149	1190	2.1e-7	PFAM
Pfam:LRRC37	1187	1258	2.5e-25	PFAM
Pfam:LRRC37	1255	1300	2.6e-7	PFAM
Pfam:LRRC37	1299	1370	2.4e-27	PFAM
Pfam:LRRC37	1369	1420	2.9e-8	PFAM
Pfam:LRRC37	1419	1488	1.3e-24	PFAM
Pfam:LRRC37	1509	1578	9.2e-21	PFAM
Pfam:LRRC37	1575	1620	1.7e-6	PFAM
Pfam:LRRC37	1619	1686	1.7e-20	PFAM
Pfam:LRRC37	1690	1736	7e-10	PFAM
Pfam:LRRC37	1733	1799	7.5e-17	PFAM
Pfam:LRRC37	1789	1854	5.1e-12	PFAM
Pfam:LRRC37	1850	1921	4.2e-21	PFAM
Pfam:LRRC37	1915	1969	1.1e-9	PFAM
low complexity region	2143	2167	N/A	INTRINSIC
low complexity region	2185	2209	N/A	INTRINSIC
low complexity region	2228	2249	N/A	INTRINSIC
low complexity region	2262	2274	N/A	INTRINSIC
low complexity region	2284	2297	N/A	INTRINSIC
LRR	2419	2438	3.09e1	SMART
LRR	2439	2462	9.96e-1	SMART
LRR	2463	2486	8.24e0	SMART
LRR	2490	2514	3.18e1	SMART
low complexity region	2535	2547	N/A	INTRINSIC
coiled coil region	2712	2735	N/A	INTRINSIC
low complexity region	2861	2871	N/A	INTRINSIC
low complexity region	2937	2950	N/A	INTRINSIC
Pfam:LRRC37AB_C	3063	3209	1.1e-77	PFAM

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

96% (99/103)

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,878	W162R	probably benign	Het
2610507B11Rik	C	A	11: 78,271,384	L691I	possibly damaging	Het
4930438A08Rik	C	A	11: 58,293,638	P394H	probably damaging	Het
Aggf1	C	T	13: 95,371,615	C81Y	probably benign	Het
Agxt2	A	T	15: 10,378,877	D188V	probably damaging	Het
Angpt2	T	C	8: 18,698,116	K376R	probably benign	Het
Anxa5	A	G	3: 36,450,691	S241P	probably damaging	Het
Aox3	A	T	1: 58,169,859	K850N	probably damaging	Het
Arid5a	T	C	1: 36,319,392	M415T	probably benign	Het
Aspa	T	A	11: 73,308,752	N233I	probably damaging	Het
Atp4b	C	T	8: 13,388,782	R198Q	probably damaging	Het
Atp8b2	A	T	3: 89,946,221	V719E	possibly damaging	Het
Cacna1s	T	G	1: 136,105,836	V1017G	probably damaging	Het
Chrna4	G	T	2: 181,029,442	Q174K	probably damaging	Het
Chrnb1	A	T	11: 69,786,939	V329D	probably damaging	Het
Chst14	T	C	2: 118,927,733	L336P	probably damaging	Het
Clec2e	T	C	6: 129,100,809	D22G	probably benign	Het
Csrnp2	A	C	15: 100,482,382	S343A	probably benign	Het
Dapl1	C	A	2: 59,484,713	A2E	probably damaging	Het
Dlec1	G	T	9: 119,121,923	R519L	probably damaging	Het
Dmgdh	T	A	13: 93,708,743	F415I	possibly damaging	Het
Dmgdh	T	C	13: 93,752,326	V824A	probably damaging	Het
Dnah11	T	G	12: 117,928,456	T3661P	probably benign	Het
Dnah3	A	G	7: 120,030,031	F1434L	probably damaging	Het
Dnajc11	C	A	4: 151,978,126		probably benign	Het
Dot1l	A	G	10: 80,786,095	E527G	probably damaging	Het
Drc7	T	C	8: 95,075,051	L680P	probably damaging	Het
Dysf	T	C	6: 84,106,862	Y742H	probably benign	Het
Ece1	A	G	4: 137,961,647	Y665C	probably damaging	Het
Emc1	A	G	4: 139,354,222	K54E	possibly damaging	Het
Enoph1	C	T	5: 100,067,901	T247M	probably damaging	Het
Exoc2	T	C	13: 30,900,829	K383R	probably benign	Het
Fam227b	A	T	2: 126,121,052	H181Q	probably damaging	Het
Fsip2	A	T	2: 82,985,673	M3917L	probably benign	Het
Gtf3a	T	A	5: 146,955,528		probably benign	Het
Hgfac	T	A	5: 35,041,629	C11*	probably null	Het
Hmcn1	C	A	1: 150,663,909	A2944S	probably damaging	Het
Hps5	T	A	7: 46,767,097	Y947F	probably benign	Het
Ighv2-5	A	T	12: 113,685,500	I111K	probably benign	Het
Inpp5e	A	T	2: 26,407,848	L247*	probably null	Het
Kbtbd11	T	C	8: 15,027,577	S59P	probably benign	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kif1a	T	C	1: 93,024,648	D1303G	probably damaging	Het
Kif7	A	G	7: 79,714,094	V22A	possibly damaging	Het
Lrit3	A	T	3: 129,789,355	C328S	probably damaging	Het
Lurap1	G	T	4: 116,137,402	P211T	possibly damaging	Het
Mbd2	T	A	18: 70,580,803	N5K	possibly damaging	Het
Mbtps1	A	C	8: 119,515,602	L894V	probably benign	Het
Mefv	G	A	16: 3,708,042	S787F	possibly damaging	Het
Miip	T	A	4: 147,862,335	I289F	probably damaging	Het
Mogat2	T	A	7: 99,223,513	I155F	possibly damaging	Het
Mpp3	C	A	11: 102,011,689		probably null	Het
Mrrf	A	G	2: 36,177,221	K220E	probably damaging	Het
Mtmr6	C	T	14: 60,298,170	P485L	probably damaging	Het
Mtor	G	A	4: 148,537,435	R1896K	probably benign	Het
Myh3	C	T	11: 67,087,545	P453S	probably benign	Het
Nebl	A	G	2: 17,450,234	V112A	probably benign	Het
Nmnat2	G	A	1: 153,074,734	W55*	probably null	Het
Nprl3	A	G	11: 32,267,432	S37P	probably damaging	Het
Olfr1246	T	C	2: 89,591,101	N5D	possibly damaging	Het
Oraov1	G	T	7: 144,915,286	V17L	possibly damaging	Het
Pcdhga4	T	G	18: 37,686,330	S311A	probably benign	Het
Pcdhgb6	T	C	18: 37,743,112	V291A	probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Peg3	T	C	7: 6,709,571	E884G	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Phf12	A	G	11: 78,009,515	T146A	probably benign	Het
Polr3k	C	G	2: 181,864,488	N10K	probably damaging	Het
Prickle4	C	A	17: 47,690,210	G144C	probably damaging	Het
Ptpn6	T	C	6: 124,732,435	Y25C	probably damaging	Het
Rad1	A	G	15: 10,488,074	I95V	probably damaging	Het
Rad23b	A	G	4: 55,382,540	T248A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rcc2	T	G	4: 140,717,024	V342G	possibly damaging	Het
Rgs3	G	T	4: 62,625,906	R136L	probably damaging	Het
Scube2	A	T	7: 109,833,013	C399*	probably null	Het
Serpinb3d	T	C	1: 107,079,722	Y178C	probably damaging	Het
Slc1a7	A	G	4: 108,012,261	T508A	probably benign	Het
Slc29a4	C	T	5: 142,720,077	R439C	probably damaging	Het
Sntg2	A	G	12: 30,312,561	I62T	probably benign	Het
Sowaha	G	A	11: 53,479,087	P274L	probably damaging	Het
Sptan1	A	G	2: 29,996,782	N869S	probably benign	Het
Stx18	C	A	5: 38,106,564	A64D	probably damaging	Het
Stxbp5	A	G	10: 9,770,686	V94A	probably benign	Het
Sult1a1	T	A	7: 126,676,452		probably null	Het
Susd1	G	T	4: 59,379,687	H313Q	possibly damaging	Het
Tdrd9	A	T	12: 111,985,041	K88N	probably damaging	Het
Tlr5	A	C	1: 182,974,038	R302S	possibly damaging	Het
Tnr	C	T	1: 159,886,909	T786I	probably damaging	Het
Tprgl	A	G	4: 154,160,095	S148P	probably damaging	Het
Trpc4ap	T	A	2: 155,671,074	N127I	probably damaging	Het
Tulp2	T	A	7: 45,490,373		probably null	Het
Uggt2	C	T	14: 119,035,969		probably null	Het
Ulk4	T	A	9: 121,272,955	Y19F	probably damaging	Het
Upf1	T	C	8: 70,333,037	Y1053C	probably damaging	Het
Vars2	A	T	17: 35,665,788	H223Q	probably benign	Het
Vmn2r106	T	A	17: 20,267,544		probably null	Het
Ythdc2	T	A	18: 44,840,210	F305I	probably damaging	Het
Zfp281	T	C	1: 136,625,440	F52S	possibly damaging	Het
Zfp292	A	T	4: 34,809,784	C1087S	probably damaging	Het
Zfp335	A	T	2: 164,895,098		probably null	Het

Other mutations in Lrrc37a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Lrrc37a	APN	11	103500351	missense	probably benign	0.09
IGL01339:Lrrc37a	APN	11	103497937	missense	unknown
IGL01352:Lrrc37a	APN	11	103499355	missense	probably benign	0.39
IGL01382:Lrrc37a	APN	11	103498755	missense	probably damaging	0.99
IGL01395:Lrrc37a	APN	11	103503861	missense	probably benign	0.24
IGL01645:Lrrc37a	APN	11	103504264	missense	probably benign	0.01
IGL01925:Lrrc37a	APN	11	103498419	missense	probably benign	0.01
IGL02006:Lrrc37a	APN	11	103456491	missense	probably damaging	1.00
IGL02127:Lrrc37a	APN	11	103504539	missense	probably benign	0.01
IGL02184:Lrrc37a	APN	11	103497609	missense	unknown
IGL02218:Lrrc37a	APN	11	103500381	missense	probably benign	0.03
IGL02436:Lrrc37a	APN	11	103498177	missense	unknown
IGL02487:Lrrc37a	APN	11	103496037	missense	unknown
IGL02597:Lrrc37a	APN	11	103504287	missense	probably benign	0.01
IGL02634:Lrrc37a	APN	11	103499112	missense	probably benign	0.09
IGL02818:Lrrc37a	APN	11	103501306	missense	possibly damaging	0.47
IGL02829:Lrrc37a	APN	11	103491174	missense	unknown
IGL02987:Lrrc37a	APN	11	103500413	missense	probably benign	0.03
IGL03081:Lrrc37a	APN	11	103456595	missense	unknown
IGL03210:Lrrc37a	APN	11	103499505	missense	probably benign	0.29
IGL03239:Lrrc37a	APN	11	103499407	missense	probably benign	0.03
IGL03285:Lrrc37a	APN	11	103497673	missense	unknown
IGL03296:Lrrc37a	APN	11	103497673	missense	unknown
IGL03299:Lrrc37a	APN	11	103497673	missense	unknown
IGL03370:Lrrc37a	APN	11	103497673	missense	unknown
IGL03390:Lrrc37a	APN	11	103496031	missense	unknown
Lark	UTSW	11	103464354	critical splice donor site	probably null
Longspur	UTSW	11	103502314	missense	probably benign	0.42
F5770:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
P0035:Lrrc37a	UTSW	11	103503132	missense	possibly damaging	0.84
PIT4458001:Lrrc37a	UTSW	11	103504512	missense	probably benign	0.04
R0112:Lrrc37a	UTSW	11	103500913	missense	probably benign	0.19
R0194:Lrrc37a	UTSW	11	103499790	missense	possibly damaging	0.82
R0360:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0364:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0395:Lrrc37a	UTSW	11	103464395	missense	unknown
R0418:Lrrc37a	UTSW	11	103503438	missense	probably benign	0.03
R0505:Lrrc37a	UTSW	11	103503025	missense	probably benign	0.10
R0583:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R1078:Lrrc37a	UTSW	11	103497631	missense	unknown
R1581:Lrrc37a	UTSW	11	103457017	nonsense	probably null
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1907:Lrrc37a	UTSW	11	103457156	missense	unknown
R1982:Lrrc37a	UTSW	11	103498966	missense	probably benign	0.20
R1991:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2017:Lrrc37a	UTSW	11	103501125	missense	probably benign	0.03
R2103:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2110:Lrrc37a	UTSW	11	103497822	missense	unknown
R2190:Lrrc37a	UTSW	11	103500043	missense	possibly damaging	0.82
R2252:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2253:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2894:Lrrc37a	UTSW	11	103497864	missense	unknown
R2899:Lrrc37a	UTSW	11	103497864	missense	unknown
R3439:Lrrc37a	UTSW	11	103497864	missense	unknown
R3899:Lrrc37a	UTSW	11	103497546	missense	unknown
R3916:Lrrc37a	UTSW	11	103455518	missense	possibly damaging	0.83
R3921:Lrrc37a	UTSW	11	103501470	missense	probably benign	0.10
R3977:Lrrc37a	UTSW	11	103457604	missense	unknown
R4043:Lrrc37a	UTSW	11	103498653	missense	possibly damaging	0.95
R4077:Lrrc37a	UTSW	11	103497982	missense	unknown
R4237:Lrrc37a	UTSW	11	103502289	missense	probably damaging	0.97
R4461:Lrrc37a	UTSW	11	103464354	critical splice donor site	probably null
R4498:Lrrc37a	UTSW	11	103501798	missense	probably benign	0.20
R4593:Lrrc37a	UTSW	11	103498969	missense	possibly damaging	0.64
R4670:Lrrc37a	UTSW	11	103504537	missense	probably benign	0.10
R4698:Lrrc37a	UTSW	11	103504104	missense	possibly damaging	0.83
R4750:Lrrc37a	UTSW	11	103455480	missense	probably benign	0.24
R4805:Lrrc37a	UTSW	11	103504309	missense	probably benign	0.01
R4940:Lrrc37a	UTSW	11	103497612	missense	unknown
R4983:Lrrc37a	UTSW	11	103497618	missense	unknown
R4989:Lrrc37a	UTSW	11	103456739	missense	unknown
R5046:Lrrc37a	UTSW	11	103498240	missense	unknown
R5217:Lrrc37a	UTSW	11	103456954	missense	unknown
R5300:Lrrc37a	UTSW	11	103456958	missense	unknown
R5509:Lrrc37a	UTSW	11	103500535	missense	probably benign	0.23
R5550:Lrrc37a	UTSW	11	103498177	missense	unknown
R5655:Lrrc37a	UTSW	11	103498555	missense	probably benign	0.28
R5668:Lrrc37a	UTSW	11	103500175	missense	probably benign	0.03
R5750:Lrrc37a	UTSW	11	103458097	missense	unknown
R5815:Lrrc37a	UTSW	11	103503786	missense	probably benign	0.01
R5976:Lrrc37a	UTSW	11	103499071	missense	possibly damaging	0.73
R5990:Lrrc37a	UTSW	11	103500958	missense	probably benign	0.19
R6004:Lrrc37a	UTSW	11	103502536	missense	possibly damaging	0.56
R6019:Lrrc37a	UTSW	11	103456596	missense	unknown
R6125:Lrrc37a	UTSW	11	103501560	missense	probably benign	0.19
R6190:Lrrc37a	UTSW	11	103501216	missense	possibly damaging	0.67
R6295:Lrrc37a	UTSW	11	103497633	missense	unknown
R6320:Lrrc37a	UTSW	11	103504051	missense	probably benign	0.10
R6354:Lrrc37a	UTSW	11	103464387	missense	unknown
R6375:Lrrc37a	UTSW	11	103501089	missense	probably benign	0.19
R6406:Lrrc37a	UTSW	11	103497535	missense	unknown
R6468:Lrrc37a	UTSW	11	103460840	missense	unknown
R6490:Lrrc37a	UTSW	11	103456660	missense	unknown
R6502:Lrrc37a	UTSW	11	103492179	missense	unknown
R6509:Lrrc37a	UTSW	11	103504414	missense	probably benign	0.04
R6749:Lrrc37a	UTSW	11	103502097	missense	probably benign	0.29
R6768:Lrrc37a	UTSW	11	103500123	missense	probably benign	0.36
R6912:Lrrc37a	UTSW	11	103457543	missense	unknown
R7081:Lrrc37a	UTSW	11	103457955	missense	unknown
R7083:Lrrc37a	UTSW	11	103503340	missense	probably benign	0.03
R7154:Lrrc37a	UTSW	11	103502856	missense	probably benign	0.03
R7195:Lrrc37a	UTSW	11	103457775	missense	unknown
R7265:Lrrc37a	UTSW	11	103498941	missense	probably benign	0.09
R7276:Lrrc37a	UTSW	11	103456746	missense	unknown
R7362:Lrrc37a	UTSW	11	103457509	missense	unknown
R7450:Lrrc37a	UTSW	11	103498326	missense	probably benign	0.01
R7458:Lrrc37a	UTSW	11	103497432	missense	unknown
R7487:Lrrc37a	UTSW	11	103498219	missense	unknown
R7535:Lrrc37a	UTSW	11	103501857	missense	possibly damaging	0.68
R7593:Lrrc37a	UTSW	11	103500952	missense	probably benign	0.03
R7677:Lrrc37a	UTSW	11	103499638	missense	probably benign	0.26
R7686:Lrrc37a	UTSW	11	103498236	missense	unknown
R7694:Lrrc37a	UTSW	11	103504378	missense	probably benign	0.12
R7696:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R7717:Lrrc37a	UTSW	11	103504300	missense	probably benign	0.01
R7736:Lrrc37a	UTSW	11	103497459	missense	unknown
R7841:Lrrc37a	UTSW	11	103501105	missense	probably benign	0.03
R7885:Lrrc37a	UTSW	11	103503042	missense	probably benign	0.01
R7888:Lrrc37a	UTSW	11	103501481	missense	probably benign	0.19
R7993:Lrrc37a	UTSW	11	103457961	missense	unknown
R8051:Lrrc37a	UTSW	11	103503126	missense	possibly damaging	0.48
R8082:Lrrc37a	UTSW	11	103457422	missense	unknown
R8097:Lrrc37a	UTSW	11	103504099	missense	probably benign	0.04
R8108:Lrrc37a	UTSW	11	103503057	missense	probably benign	0.24
R8269:Lrrc37a	UTSW	11	103497898	missense	unknown
R8311:Lrrc37a	UTSW	11	103503421	missense	probably benign	0.05
R8403:Lrrc37a	UTSW	11	103501585	missense	probably benign	0.10
R8408:Lrrc37a	UTSW	11	103460809	missense	unknown
R8529:Lrrc37a	UTSW	11	103457547	missense	unknown
R8711:Lrrc37a	UTSW	11	103497524	nonsense	probably null
R8757:Lrrc37a	UTSW	11	103457940	missense	unknown
R8759:Lrrc37a	UTSW	11	103457940	missense	unknown
R8769:Lrrc37a	UTSW	11	103498710	missense	probably benign	0.10
R8785:Lrrc37a	UTSW	11	103456416	missense	probably damaging	1.00
R8837:Lrrc37a	UTSW	11	103503969	missense	probably benign	0.43
R8850:Lrrc37a	UTSW	11	103502655	missense
R8871:Lrrc37a	UTSW	11	103456549	missense	unknown
R8894:Lrrc37a	UTSW	11	103456623	missense	unknown
R8971:Lrrc37a	UTSW	11	103500664	missense	probably benign	0.19
R8979:Lrrc37a	UTSW	11	103503007	missense	possibly damaging	0.48
R9012:Lrrc37a	UTSW	11	103499152	missense	probably benign	0.05
R9047:Lrrc37a	UTSW	11	103500549	missense	probably damaging	0.97
R9167:Lrrc37a	UTSW	11	103456832	missense	unknown
R9171:Lrrc37a	UTSW	11	103502314	missense	probably benign	0.42
R9194:Lrrc37a	UTSW	11	103500850	missense	probably benign	0.03
R9258:Lrrc37a	UTSW	11	103502196	missense	probably benign	0.20
R9282:Lrrc37a	UTSW	11	103500807	missense	probably benign	0.03
R9294:Lrrc37a	UTSW	11	103504533	missense	probably benign	0.10
R9349:Lrrc37a	UTSW	11	103497628	missense	unknown
R9560:Lrrc37a	UTSW	11	103456594	missense	unknown
R9595:Lrrc37a	UTSW	11	103501726	missense	probably benign	0.01
R9628:Lrrc37a	UTSW	11	103503504	missense	probably benign	0.03
V7580:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
X0018:Lrrc37a	UTSW	11	103499544	missense	possibly damaging	0.78
Z1176:Lrrc37a	UTSW	11	103456486	missense	probably damaging	1.00
Z1176:Lrrc37a	UTSW	11	103499034	missense	possibly damaging	0.68
Z1176:Lrrc37a	UTSW	11	103501094	missense	probably benign	0.09
Z1177:Lrrc37a	UTSW	11	103499967	missense	possibly damaging	0.46
Z1177:Lrrc37a	UTSW	11	103500520	missense	probably benign	0.43
Z1177:Lrrc37a	UTSW	11	103500598	missense	probably benign	0.20
Z1177:Lrrc37a	UTSW	11	103503027	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- AAATGGTTAGGGTGCCCTTG -3'
(R):5'- TCCACACACTACGAGGTGGTAC -3'

Posted On

2017-07-14