Incidental Mutation 'R6056:Aggf1'
ID 484429
Institutional Source Beutler Lab
Gene Symbol Aggf1
Ensembl Gene ENSMUSG00000021681
Gene Name angiogenic factor with G patch and FHA domains 1
Synonyms 2310029P06Rik, 2010009L17Rik, VG5Q
MMRRC Submission 044223-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.490) question?
Stock # R6056 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 95487191-95511860 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95508123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 81 (C81Y)
Ref Sequence ENSEMBL: ENSMUSP00000022189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022189]
AlphaFold Q7TN31
Predicted Effect probably benign
Transcript: ENSMUST00000022189
AA Change: C81Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000022189
Gene: ENSMUSG00000021681
AA Change: C81Y

DomainStartEndE-ValueType
coiled coil region 20 85 N/A INTRINSIC
low complexity region 128 137 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
internal_repeat_1 205 225 4.68e-9 PROSPERO
internal_repeat_1 221 241 4.68e-9 PROSPERO
low complexity region 270 280 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 380 401 N/A INTRINSIC
FHA 430 484 1.51e-9 SMART
low complexity region 548 561 N/A INTRINSIC
G_patch 614 660 1.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161671
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null embryos die before E8.5. Heterozygotes exhibit defective angiogenesis in yolk sacs and embryos and partial lethality. Surviving adults show hemorrhages, increased vascular permeability, and reduced tumor growth of implanted melanoma cell lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,115 (GRCm39) W162R probably benign Het
4930438A08Rik C A 11: 58,184,464 (GRCm39) P394H probably damaging Het
Agxt2 A T 15: 10,378,963 (GRCm39) D188V probably damaging Het
Angpt2 T C 8: 18,748,132 (GRCm39) K376R probably benign Het
Anxa5 A G 3: 36,504,840 (GRCm39) S241P probably damaging Het
Aox3 A T 1: 58,209,018 (GRCm39) K850N probably damaging Het
Arid5a T C 1: 36,358,473 (GRCm39) M415T probably benign Het
Aspa T A 11: 73,199,578 (GRCm39) N233I probably damaging Het
Atp4b C T 8: 13,438,782 (GRCm39) R198Q probably damaging Het
Atp8b2 A T 3: 89,853,528 (GRCm39) V719E possibly damaging Het
Bltp2 C A 11: 78,162,210 (GRCm39) L691I possibly damaging Het
Cacna1s T G 1: 136,033,574 (GRCm39) V1017G probably damaging Het
Chrna4 G T 2: 180,671,235 (GRCm39) Q174K probably damaging Het
Chrnb1 A T 11: 69,677,765 (GRCm39) V329D probably damaging Het
Chst14 T C 2: 118,758,214 (GRCm39) L336P probably damaging Het
Clec2e T C 6: 129,077,772 (GRCm39) D22G probably benign Het
Csrnp2 A C 15: 100,380,263 (GRCm39) S343A probably benign Het
Dapl1 C A 2: 59,315,057 (GRCm39) A2E probably damaging Het
Dlec1 G T 9: 118,950,991 (GRCm39) R519L probably damaging Het
Dmgdh T A 13: 93,845,251 (GRCm39) F415I possibly damaging Het
Dmgdh T C 13: 93,888,834 (GRCm39) V824A probably damaging Het
Dnah11 T G 12: 117,892,191 (GRCm39) T3661P probably benign Het
Dnah3 A G 7: 119,629,254 (GRCm39) F1434L probably damaging Het
Dnajc11 C A 4: 152,062,583 (GRCm39) probably benign Het
Dot1l A G 10: 80,621,929 (GRCm39) E527G probably damaging Het
Drc7 T C 8: 95,801,679 (GRCm39) L680P probably damaging Het
Dysf T C 6: 84,083,844 (GRCm39) Y742H probably benign Het
Ece1 A G 4: 137,688,958 (GRCm39) Y665C probably damaging Het
Emc1 A G 4: 139,081,533 (GRCm39) K54E possibly damaging Het
Enoph1 C T 5: 100,215,760 (GRCm39) T247M probably damaging Het
Exoc2 T C 13: 31,084,812 (GRCm39) K383R probably benign Het
Fam227b A T 2: 125,962,972 (GRCm39) H181Q probably damaging Het
Fsip2 A T 2: 82,816,017 (GRCm39) M3917L probably benign Het
Gtf3a T A 5: 146,892,338 (GRCm39) probably benign Het
Hgfac T A 5: 35,198,973 (GRCm39) C11* probably null Het
Hmcn1 C A 1: 150,539,660 (GRCm39) A2944S probably damaging Het
Hps5 T A 7: 46,416,521 (GRCm39) Y947F probably benign Het
Ighv2-5 A T 12: 113,649,120 (GRCm39) I111K probably benign Het
Inpp5e A T 2: 26,297,860 (GRCm39) L247* probably null Het
Kbtbd11 T C 8: 15,077,577 (GRCm39) S59P probably benign Het
Kctd19 G A 8: 106,123,082 (GRCm39) H111Y probably damaging Het
Kif1a T C 1: 92,952,370 (GRCm39) D1303G probably damaging Het
Kif7 A G 7: 79,363,842 (GRCm39) V22A possibly damaging Het
Lrit3 A T 3: 129,583,004 (GRCm39) C328S probably damaging Het
Lrrc37a G T 11: 103,388,484 (GRCm39) Q2314K unknown Het
LTO1 G T 7: 144,469,023 (GRCm39) V17L possibly damaging Het
Lurap1 G T 4: 115,994,599 (GRCm39) P211T possibly damaging Het
Mbd2 T A 18: 70,713,874 (GRCm39) N5K possibly damaging Het
Mbtps1 A C 8: 120,242,341 (GRCm39) L894V probably benign Het
Mefv G A 16: 3,525,906 (GRCm39) S787F possibly damaging Het
Miip T A 4: 147,946,792 (GRCm39) I289F probably damaging Het
Mogat2 T A 7: 98,872,720 (GRCm39) I155F possibly damaging Het
Mpp3 C A 11: 101,902,515 (GRCm39) probably null Het
Mrrf A G 2: 36,067,233 (GRCm39) K220E probably damaging Het
Mtmr6 C T 14: 60,535,619 (GRCm39) P485L probably damaging Het
Mtor G A 4: 148,621,892 (GRCm39) R1896K probably benign Het
Myh3 C T 11: 66,978,371 (GRCm39) P453S probably benign Het
Nebl A G 2: 17,455,045 (GRCm39) V112A probably benign Het
Nmnat2 G A 1: 152,950,480 (GRCm39) W55* probably null Het
Nprl3 A G 11: 32,217,432 (GRCm39) S37P probably damaging Het
Or4a73 T C 2: 89,421,445 (GRCm39) N5D possibly damaging Het
Pcdhga4 T G 18: 37,819,383 (GRCm39) S311A probably benign Het
Pcdhgb6 T C 18: 37,876,165 (GRCm39) V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Peg3 T C 7: 6,712,570 (GRCm39) E884G probably damaging Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Phf12 A G 11: 77,900,341 (GRCm39) T146A probably benign Het
Polr3k C G 2: 181,506,281 (GRCm39) N10K probably damaging Het
Prickle4 C A 17: 48,001,135 (GRCm39) G144C probably damaging Het
Ptpn6 T C 6: 124,709,398 (GRCm39) Y25C probably damaging Het
Rad1 A G 15: 10,488,160 (GRCm39) I95V probably damaging Het
Rad23b A G 4: 55,382,540 (GRCm39) T248A probably benign Het
Rapgef3 T C 15: 97,656,742 (GRCm39) D299G probably damaging Het
Rcc2 T G 4: 140,444,335 (GRCm39) V342G possibly damaging Het
Rgs3 G T 4: 62,544,143 (GRCm39) R136L probably damaging Het
Scube2 A T 7: 109,432,220 (GRCm39) C399* probably null Het
Serpinb3d T C 1: 107,007,452 (GRCm39) Y178C probably damaging Het
Slc1a7 A G 4: 107,869,458 (GRCm39) T508A probably benign Het
Slc29a4 C T 5: 142,705,832 (GRCm39) R439C probably damaging Het
Sntg2 A G 12: 30,362,560 (GRCm39) I62T probably benign Het
Sowaha G A 11: 53,369,914 (GRCm39) P274L probably damaging Het
Sptan1 A G 2: 29,886,794 (GRCm39) N869S probably benign Het
Stx18 C A 5: 38,263,908 (GRCm39) A64D probably damaging Het
Stxbp5 A G 10: 9,646,430 (GRCm39) V94A probably benign Het
Sult1a1 T A 7: 126,275,624 (GRCm39) probably null Het
Susd1 G T 4: 59,379,687 (GRCm39) H313Q possibly damaging Het
Tdrd9 A T 12: 111,951,475 (GRCm39) K88N probably damaging Het
Tlr5 A C 1: 182,801,603 (GRCm39) R302S possibly damaging Het
Tnr C T 1: 159,714,479 (GRCm39) T786I probably damaging Het
Tprg1l A G 4: 154,244,552 (GRCm39) S148P probably damaging Het
Trpc4ap T A 2: 155,512,994 (GRCm39) N127I probably damaging Het
Tulp2 T A 7: 45,139,797 (GRCm39) probably null Het
Uggt2 C T 14: 119,273,381 (GRCm39) probably null Het
Ulk4 T A 9: 121,102,021 (GRCm39) Y19F probably damaging Het
Upf1 T C 8: 70,785,687 (GRCm39) Y1053C probably damaging Het
Vars2 A T 17: 35,976,680 (GRCm39) H223Q probably benign Het
Vmn2r106 T A 17: 20,487,806 (GRCm39) probably null Het
Ythdc2 T A 18: 44,973,277 (GRCm39) F305I probably damaging Het
Zfp281 T C 1: 136,553,178 (GRCm39) F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 (GRCm39) C1087S probably damaging Het
Zfp335 A T 2: 164,737,018 (GRCm39) probably null Het
Other mutations in Aggf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Aggf1 APN 13 95,498,985 (GRCm39) missense probably damaging 1.00
IGL01083:Aggf1 APN 13 95,492,917 (GRCm39) missense probably damaging 1.00
IGL01296:Aggf1 APN 13 95,490,479 (GRCm39) missense probably damaging 1.00
IGL01811:Aggf1 APN 13 95,488,080 (GRCm39) missense probably benign 0.04
IGL02089:Aggf1 APN 13 95,507,437 (GRCm39) missense probably benign 0.22
IGL02351:Aggf1 APN 13 95,489,358 (GRCm39) splice site probably benign
IGL02358:Aggf1 APN 13 95,489,358 (GRCm39) splice site probably benign
IGL02534:Aggf1 APN 13 95,506,030 (GRCm39) missense possibly damaging 0.76
PIT4687001:Aggf1 UTSW 13 95,501,383 (GRCm39) missense probably damaging 0.99
R0090:Aggf1 UTSW 13 95,501,467 (GRCm39) missense probably benign 0.01
R0189:Aggf1 UTSW 13 95,492,988 (GRCm39) splice site probably benign
R0332:Aggf1 UTSW 13 95,505,954 (GRCm39) missense probably damaging 1.00
R0334:Aggf1 UTSW 13 95,508,105 (GRCm39) missense probably benign 0.02
R0445:Aggf1 UTSW 13 95,490,509 (GRCm39) missense possibly damaging 0.74
R0523:Aggf1 UTSW 13 95,492,924 (GRCm39) missense probably damaging 0.99
R0575:Aggf1 UTSW 13 95,504,905 (GRCm39) missense probably benign 0.02
R0647:Aggf1 UTSW 13 95,508,164 (GRCm39) splice site probably null
R1401:Aggf1 UTSW 13 95,501,356 (GRCm39) missense probably benign 0.02
R1495:Aggf1 UTSW 13 95,492,921 (GRCm39) nonsense probably null
R1542:Aggf1 UTSW 13 95,507,450 (GRCm39) missense probably benign 0.00
R1688:Aggf1 UTSW 13 95,501,275 (GRCm39) missense probably damaging 1.00
R2225:Aggf1 UTSW 13 95,507,354 (GRCm39) missense probably damaging 0.96
R2226:Aggf1 UTSW 13 95,507,354 (GRCm39) missense probably damaging 0.96
R4405:Aggf1 UTSW 13 95,508,102 (GRCm39) missense probably benign 0.00
R4764:Aggf1 UTSW 13 95,501,221 (GRCm39) missense probably damaging 0.96
R5819:Aggf1 UTSW 13 95,488,129 (GRCm39) missense possibly damaging 0.76
R5878:Aggf1 UTSW 13 95,506,065 (GRCm39) missense probably benign 0.18
R5946:Aggf1 UTSW 13 95,508,084 (GRCm39) missense probably damaging 1.00
R6823:Aggf1 UTSW 13 95,501,231 (GRCm39) missense probably benign 0.11
R7051:Aggf1 UTSW 13 95,488,125 (GRCm39) missense possibly damaging 0.94
R7638:Aggf1 UTSW 13 95,492,921 (GRCm39) nonsense probably null
R7682:Aggf1 UTSW 13 95,504,934 (GRCm39) missense probably benign 0.41
R7903:Aggf1 UTSW 13 95,492,966 (GRCm39) missense probably damaging 1.00
R9387:Aggf1 UTSW 13 95,507,461 (GRCm39) missense probably damaging 1.00
R9502:Aggf1 UTSW 13 95,507,450 (GRCm39) missense probably benign 0.00
RF014:Aggf1 UTSW 13 95,507,276 (GRCm39) missense possibly damaging 0.87
X0010:Aggf1 UTSW 13 95,501,485 (GRCm39) missense probably benign
X0064:Aggf1 UTSW 13 95,499,378 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGTGCAGCACTGAAAACATAC -3'
(R):5'- AGCCTTGACTTGTGAATGCTG -3'

Posted On 2017-07-14