Incidental Mutation 'R6056:Uggt2'
ID484431
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
MMRRC Submission 044223-MU
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6056 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 119035969 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203] [ENSMUST00000156203]
Predicted Effect probably benign
Transcript: ENSMUST00000127153
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153693
SMART Domains Protein: ENSMUSP00000123327
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 106 3.3e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156203
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000156203
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173470
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,878 W162R probably benign Het
2610507B11Rik C A 11: 78,271,384 L691I possibly damaging Het
4930438A08Rik C A 11: 58,293,638 P394H probably damaging Het
Aggf1 C T 13: 95,371,615 C81Y probably benign Het
Agxt2 A T 15: 10,378,877 D188V probably damaging Het
Angpt2 T C 8: 18,698,116 K376R probably benign Het
Anxa5 A G 3: 36,450,691 S241P probably damaging Het
Aox3 A T 1: 58,169,859 K850N probably damaging Het
Arid5a T C 1: 36,319,392 M415T probably benign Het
Aspa T A 11: 73,308,752 N233I probably damaging Het
Atp4b C T 8: 13,388,782 R198Q probably damaging Het
Atp8b2 A T 3: 89,946,221 V719E possibly damaging Het
Cacna1s T G 1: 136,105,836 V1017G probably damaging Het
Chrna4 G T 2: 181,029,442 Q174K probably damaging Het
Chrnb1 A T 11: 69,786,939 V329D probably damaging Het
Chst14 T C 2: 118,927,733 L336P probably damaging Het
Clec2e T C 6: 129,100,809 D22G probably benign Het
Csrnp2 A C 15: 100,482,382 S343A probably benign Het
Dapl1 C A 2: 59,484,713 A2E probably damaging Het
Dlec1 G T 9: 119,121,923 R519L probably damaging Het
Dmgdh T A 13: 93,708,743 F415I possibly damaging Het
Dmgdh T C 13: 93,752,326 V824A probably damaging Het
Dnah11 T G 12: 117,928,456 T3661P probably benign Het
Dnah3 A G 7: 120,030,031 F1434L probably damaging Het
Dnajc11 C A 4: 151,978,126 probably benign Het
Dot1l A G 10: 80,786,095 E527G probably damaging Het
Drc7 T C 8: 95,075,051 L680P probably damaging Het
Dysf T C 6: 84,106,862 Y742H probably benign Het
Ece1 A G 4: 137,961,647 Y665C probably damaging Het
Emc1 A G 4: 139,354,222 K54E possibly damaging Het
Enoph1 C T 5: 100,067,901 T247M probably damaging Het
Exoc2 T C 13: 30,900,829 K383R probably benign Het
Fam227b A T 2: 126,121,052 H181Q probably damaging Het
Fsip2 A T 2: 82,985,673 M3917L probably benign Het
Gtf3a T A 5: 146,955,528 probably benign Het
Hgfac T A 5: 35,041,629 C11* probably null Het
Hmcn1 C A 1: 150,663,909 A2944S probably damaging Het
Hps5 T A 7: 46,767,097 Y947F probably benign Het
Ighv2-5 A T 12: 113,685,500 I111K probably benign Het
Inpp5e A T 2: 26,407,848 L247* probably null Het
Kbtbd11 T C 8: 15,027,577 S59P probably benign Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kif1a T C 1: 93,024,648 D1303G probably damaging Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Lrit3 A T 3: 129,789,355 C328S probably damaging Het
Lrrc37a G T 11: 103,497,658 Q2314K unknown Het
Lurap1 G T 4: 116,137,402 P211T possibly damaging Het
Mbd2 T A 18: 70,580,803 N5K possibly damaging Het
Mbtps1 A C 8: 119,515,602 L894V probably benign Het
Mefv G A 16: 3,708,042 S787F possibly damaging Het
Miip T A 4: 147,862,335 I289F probably damaging Het
Mogat2 T A 7: 99,223,513 I155F possibly damaging Het
Mpp3 C A 11: 102,011,689 probably null Het
Mrrf A G 2: 36,177,221 K220E probably damaging Het
Mtmr6 C T 14: 60,298,170 P485L probably damaging Het
Mtor G A 4: 148,537,435 R1896K probably benign Het
Myh3 C T 11: 67,087,545 P453S probably benign Het
Nebl A G 2: 17,450,234 V112A probably benign Het
Nmnat2 G A 1: 153,074,734 W55* probably null Het
Nprl3 A G 11: 32,267,432 S37P probably damaging Het
Olfr1246 T C 2: 89,591,101 N5D possibly damaging Het
Oraov1 G T 7: 144,915,286 V17L possibly damaging Het
Pcdhga4 T G 18: 37,686,330 S311A probably benign Het
Pcdhgb6 T C 18: 37,743,112 V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg3 T C 7: 6,709,571 E884G probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Phf12 A G 11: 78,009,515 T146A probably benign Het
Polr3k C G 2: 181,864,488 N10K probably damaging Het
Prickle4 C A 17: 47,690,210 G144C probably damaging Het
Ptpn6 T C 6: 124,732,435 Y25C probably damaging Het
Rad1 A G 15: 10,488,074 I95V probably damaging Het
Rad23b A G 4: 55,382,540 T248A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rcc2 T G 4: 140,717,024 V342G possibly damaging Het
Rgs3 G T 4: 62,625,906 R136L probably damaging Het
Scube2 A T 7: 109,833,013 C399* probably null Het
Serpinb3d T C 1: 107,079,722 Y178C probably damaging Het
Slc1a7 A G 4: 108,012,261 T508A probably benign Het
Slc29a4 C T 5: 142,720,077 R439C probably damaging Het
Sntg2 A G 12: 30,312,561 I62T probably benign Het
Sowaha G A 11: 53,479,087 P274L probably damaging Het
Sptan1 A G 2: 29,996,782 N869S probably benign Het
Stx18 C A 5: 38,106,564 A64D probably damaging Het
Stxbp5 A G 10: 9,770,686 V94A probably benign Het
Sult1a1 T A 7: 126,676,452 probably null Het
Susd1 G T 4: 59,379,687 H313Q possibly damaging Het
Tdrd9 A T 12: 111,985,041 K88N probably damaging Het
Tlr5 A C 1: 182,974,038 R302S possibly damaging Het
Tnr C T 1: 159,886,909 T786I probably damaging Het
Tprgl A G 4: 154,160,095 S148P probably damaging Het
Trpc4ap T A 2: 155,671,074 N127I probably damaging Het
Tulp2 T A 7: 45,490,373 probably null Het
Ulk4 T A 9: 121,272,955 Y19F probably damaging Het
Upf1 T C 8: 70,333,037 Y1053C probably damaging Het
Vars2 A T 17: 35,665,788 H223Q probably benign Het
Vmn2r106 T A 17: 20,267,544 probably null Het
Ythdc2 T A 18: 44,840,210 F305I probably damaging Het
Zfp281 T C 1: 136,625,440 F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Zfp335 A T 2: 164,895,098 probably null Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0383:Uggt2 UTSW 14 119049451 missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119075329 critical splice donor site probably null
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119057598 missense probably benign 0.27
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119019558 missense probably benign
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5423:Uggt2 UTSW 14 119019486 missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119077724 missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
R7117:Uggt2 UTSW 14 119014526 missense probably benign 0.25
R7183:Uggt2 UTSW 14 119019637 splice site probably null
R7337:Uggt2 UTSW 14 119086175 missense probably benign 0.28
R7342:Uggt2 UTSW 14 118994972 missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119089269 missense probably benign 0.12
R7625:Uggt2 UTSW 14 119026493 missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119075347 missense probably damaging 1.00
R7842:Uggt2 UTSW 14 118998104 missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119042647 missense probably benign 0.09
R7925:Uggt2 UTSW 14 118998104 missense probably damaging 1.00
R7974:Uggt2 UTSW 14 119042647 missense probably benign 0.09
R8050:Uggt2 UTSW 14 119026422 missense probably damaging 0.98
Z1177:Uggt2 UTSW 14 119007296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCACTGTCCCTAGCCAG -3'
(R):5'- CGTCTCCTGGAAGATATCTGAC -3'

Posted On2017-07-14