Incidental Mutation 'R5368:Acbd3'
ID484443
Institutional Source Beutler Lab
Gene Symbol Acbd3
Ensembl Gene ENSMUSG00000026499
Gene Nameacyl-Coenzyme A binding domain containing 3
SynonymsD1Ertd10e, 8430407O11Rik, Pap7, Gocap1
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5368 (G1)
Quality Score42
Status Validated
Chromosome1
Chromosomal Location180726043-180754204 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 180722095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027780]
Predicted Effect probably benign
Transcript: ENSMUST00000027780
SMART Domains Protein: ENSMUSP00000027780
Gene: ENSMUSG00000026499

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ACBP 81 167 3.2e-18 PFAM
coiled coil region 173 252 N/A INTRINSIC
low complexity region 268 305 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Pfam:GOLD_2 394 524 2.5e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192796
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Acbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Acbd3 APN 1 180745105 missense possibly damaging 0.61
R0321:Acbd3 UTSW 1 180752305 missense probably damaging 1.00
R0365:Acbd3 UTSW 1 180738612 missense probably damaging 1.00
R0524:Acbd3 UTSW 1 180747059 small deletion probably benign
R0733:Acbd3 UTSW 1 180752218 missense possibly damaging 0.75
R0884:Acbd3 UTSW 1 180747059 small deletion probably benign
R1074:Acbd3 UTSW 1 180738548 nonsense probably null
R1327:Acbd3 UTSW 1 180733183 missense possibly damaging 0.95
R1352:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R1820:Acbd3 UTSW 1 180745138 missense probably benign 0.13
R4697:Acbd3 UTSW 1 180721944 unclassified probably benign
R5187:Acbd3 UTSW 1 180736732 nonsense probably null
R5217:Acbd3 UTSW 1 180726373 missense probably benign 0.18
R6018:Acbd3 UTSW 1 180752338 missense possibly damaging 0.88
R7072:Acbd3 UTSW 1 180726369 missense probably benign
R7366:Acbd3 UTSW 1 180734499 missense probably benign 0.41
X0027:Acbd3 UTSW 1 180747030 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGGATCAATGTGCGGATTGAGC -3'
(R):5'- CCAGACTGGCCTAAAACCTG -3'

Sequencing Primer
(F):5'- CAGGGACAGCTTCCTGAAG -3'
(R):5'- AGACAGGGTTTCTCTGTATAGCCC -3'
Posted On2017-07-14