Incidental Mutation 'R5482:Bik'
ID484453
Institutional Source Beutler Lab
Gene Symbol Bik
Ensembl Gene ENSMUSG00000016758
Gene NameBCL2-interacting killer
SynonymsNbk, Biklk, Blk
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5482 (G1)
Quality Score151
Status Validated
Chromosome15
Chromosomal Location83526862-83544634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83544134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 121 (V121G)
Ref Sequence ENSEMBL: ENSMUSP00000155439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000061882] [ENSMUST00000229165] [ENSMUST00000229724] [ENSMUST00000229964] [ENSMUST00000230912]
Predicted Effect probably damaging
Transcript: ENSMUST00000016902
AA Change: V121G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758
AA Change: V121G

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061882
SMART Domains Protein: ENSMUSP00000051569
Gene: ENSMUSG00000048755

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl_transf_1 62 342 5.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229165
AA Change: V121G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000229724
Predicted Effect probably damaging
Transcript: ENSMUST00000229964
AA Change: V77G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000230851
Predicted Effect probably damaging
Transcript: ENSMUST00000230912
AA Change: V121G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.1634 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a critical BH3 domain with other death-promoting proteins, such as BID, BAK, BAD and BAX, that is required for its pro-apoptotic activity, and for interaction with anti-apoptotic members of the BCL2 family, and viral survival-promoting proteins. Since the activity of this protein is suppressed in the presence of survival-promoting proteins, it is suggested as a likely target for anti-apoptotic proteins. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and grossly normal with no detectable changes in hematopoiesis, lymphocyte susceptibility to various apoptotic stimuli, or endothelial cell apoptosis in hyaloid vessel regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Bik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2165:Bik UTSW 15 83541423 missense probably benign 0.00
R4568:Bik UTSW 15 83541444 critical splice donor site probably null
R6830:Bik UTSW 15 83544208 missense probably benign
R7270:Bik UTSW 15 83544163 missense possibly damaging 0.71
R7746:Bik UTSW 15 83541334 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GGTTCAAGTCCACACAGTGC -3'
(R):5'- GACAGTCAGAAAACACCTCAGTTAG -3'

Sequencing Primer
(F):5'- AGGGAGCCTTCCTCTAAGAG -3'
(R):5'- TCAGTTAGGGTGCCGGCAC -3'
Posted On2017-07-18