Incidental Mutation 'R5506:Ecm1'
ID484465
Institutional Source Beutler Lab
Gene Symbol Ecm1
Ensembl Gene ENSMUSG00000028108
Gene Nameextracellular matrix protein 1
Synonymsp85
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5506 (G1)
Quality Score67
Status Validated
Chromosome3
Chromosomal Location95734147-95739569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95735857 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 377 (T377I)
Ref Sequence ENSEMBL: ENSMUSP00000112665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000029753] [ENSMUST00000074339] [ENSMUST00000117507] [ENSMUST00000123143] [ENSMUST00000128885] [ENSMUST00000131376] [ENSMUST00000137912] [ENSMUST00000147217] [ENSMUST00000153026] [ENSMUST00000199464] [ENSMUST00000196077] [ENSMUST00000163530]
Predicted Effect probably benign
Transcript: ENSMUST00000029752
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029753
AA Change: T376I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029753
Gene: ENSMUSG00000028108
AA Change: T376I

DomainStartEndE-ValueType
Pfam:ECM1 1 558 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074339
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117507
AA Change: T377I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112665
Gene: ENSMUSG00000028108
AA Change: T377I

DomainStartEndE-ValueType
Pfam:ECM1 1 559 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123143
SMART Domains Protein: ENSMUSP00000120300
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 266 4.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128885
SMART Domains Protein: ENSMUSP00000120820
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 251 1.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131376
SMART Domains Protein: ENSMUSP00000114659
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 295 4.2e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137912
SMART Domains Protein: ENSMUSP00000122243
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 140 1.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144958
Predicted Effect probably benign
Transcript: ENSMUST00000147217
SMART Domains Protein: ENSMUSP00000115524
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 80 5.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153026
SMART Domains Protein: ENSMUSP00000114747
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 230 1.3e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155815
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163530
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Meta Mutation Damage Score 0.3837 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble protein that is involved in endochondral bone formation, angiogenesis, and tumor biology. It also interacts with a variety of extracellular and structural proteins, contributing to the maintenance of skin integrity and homeostasis. Mutations in this gene are associated with lipoid proteinosis disorder (also known as hyalinosis cutis et mucosae or Urbach-Wiethe disease) that is characterized by generalized thickening of skin, mucosae and certain viscera. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit auto-inflammatory disease and do not survive beyond 6 to 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Ecm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ecm1 APN 3 95734899 missense probably damaging 1.00
IGL01686:Ecm1 APN 3 95736064 missense probably benign
IGL01807:Ecm1 APN 3 95736579 missense probably damaging 1.00
IGL01862:Ecm1 APN 3 95734273 missense probably benign 0.08
IGL02006:Ecm1 APN 3 95734244 missense probably damaging 0.98
IGL02134:Ecm1 APN 3 95736187 missense probably damaging 1.00
IGL02210:Ecm1 APN 3 95735977 missense probably damaging 0.97
IGL02813:Ecm1 APN 3 95736786 missense probably damaging 0.99
IGL02959:Ecm1 APN 3 95737677 missense probably damaging 1.00
R0362:Ecm1 UTSW 3 95737057 missense possibly damaging 0.93
R0963:Ecm1 UTSW 3 95736588 missense possibly damaging 0.95
R1181:Ecm1 UTSW 3 95735350 missense possibly damaging 0.85
R1230:Ecm1 UTSW 3 95735426 splice site probably null
R1483:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1484:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1559:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1561:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1562:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1590:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1591:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R2110:Ecm1 UTSW 3 95735942 missense probably benign 0.14
R3236:Ecm1 UTSW 3 95734846 missense possibly damaging 0.71
R3897:Ecm1 UTSW 3 95735986 missense probably damaging 0.99
R4084:Ecm1 UTSW 3 95734363 missense probably damaging 0.98
R4770:Ecm1 UTSW 3 95737961 unclassified probably benign
R4985:Ecm1 UTSW 3 95736103 missense possibly damaging 0.55
R5861:Ecm1 UTSW 3 95736597 missense probably damaging 1.00
R7472:Ecm1 UTSW 3 95735320 missense possibly damaging 0.93
R7678:Ecm1 UTSW 3 95736182 missense probably damaging 0.97
R7704:Ecm1 UTSW 3 95736531 missense probably damaging 0.99
R7864:Ecm1 UTSW 3 95734376 missense probably benign 0.09
Z1088:Ecm1 UTSW 3 95734876 missense probably benign
Z1176:Ecm1 UTSW 3 95734876 missense probably benign
Z1177:Ecm1 UTSW 3 95734876 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCATATGTGGGGTCACG -3'
(R):5'- CCAGAATGGCATGTCCTCAG -3'

Sequencing Primer
(F):5'- GTCACGGGTGGATGAAGTC -3'
(R):5'- ATGTCCTCAGGGCCCCAG -3'
Posted On2017-07-21