Incidental Mutation 'R0520:Fggy'
ID48448
Institutional Source Beutler Lab
Gene Symbol Fggy
Ensembl Gene ENSMUSG00000028573
Gene NameFGGY carbohydrate kinase domain containing
Synonyms2310009E04Rik
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0520 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location95557507-95926939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95601103 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 152 (L152Q)
Ref Sequence ENSEMBL: ENSMUSP00000078216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043335] [ENSMUST00000079223] [ENSMUST00000107091] [ENSMUST00000131654] [ENSMUST00000134012] [ENSMUST00000150830] [ENSMUST00000177394]
Predicted Effect probably damaging
Transcript: ENSMUST00000043335
AA Change: L152Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043460
Gene: ENSMUSG00000028573
AA Change: L152Q

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 1.7e-29 PFAM
Pfam:FGGY_C 290 373 1.9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079223
AA Change: L152Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078216
Gene: ENSMUSG00000028573
AA Change: L152Q

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 3.3e-27 PFAM
Pfam:FGGY_C 290 498 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107091
SMART Domains Protein: ENSMUSP00000102706
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_N 12 78 1.7e-10 PFAM
Pfam:FGGY_C 202 410 1.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131654
SMART Domains Protein: ENSMUSP00000116264
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_N 12 82 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134012
SMART Domains Protein: ENSMUSP00000115859
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
SCOP:d1bu6o1 20 107 6e-8 SMART
PDB:3L0Q|B 25 110 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147783
Predicted Effect probably benign
Transcript: ENSMUST00000150830
SMART Domains Protein: ENSMUSP00000115546
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_N 12 79 2.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176840
Predicted Effect probably benign
Transcript: ENSMUST00000177394
SMART Domains Protein: ENSMUSP00000134881
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_N 12 77 3.9e-13 PFAM
Meta Mutation Damage Score 0.9029 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acod1 T C 14: 103,051,516 I154T possibly damaging Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Apaf1 A T 10: 91,079,989 H12Q probably damaging Het
Asic1 A T 15: 99,695,535 I291F probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Asxl3 A T 18: 22,522,986 D1351V probably damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
Krtap19-2 C T 16: 88,873,861 probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr871 G A 9: 20,212,495 V49I probably benign Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Plekhm1 T C 11: 103,394,944 I222V probably benign Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Fggy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Fggy APN 4 95837628 missense possibly damaging 0.86
IGL02377:Fggy APN 4 95623477 unclassified probably benign
IGL02417:Fggy APN 4 95849609 missense probably benign 0.01
IGL02527:Fggy APN 4 95697069 missense probably damaging 1.00
IGL02967:Fggy APN 4 95926749 missense possibly damaging 0.74
IGL03053:Fggy APN 4 95926809 unclassified probably benign
IGL03168:Fggy APN 4 95926809 unclassified probably benign
IGL03370:Fggy APN 4 95822064 missense probably damaging 1.00
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0312:Fggy UTSW 4 95844185 missense probably damaging 1.00
R0747:Fggy UTSW 4 95812100 splice site probably benign
R0940:Fggy UTSW 4 95697001 missense probably benign 0.40
R1513:Fggy UTSW 4 95902058 intron probably benign
R1746:Fggy UTSW 4 95926728 missense probably damaging 1.00
R2998:Fggy UTSW 4 95849585 missense probably benign 0.01
R3848:Fggy UTSW 4 95601124 unclassified probably benign
R4913:Fggy UTSW 4 95697076 critical splice donor site probably null
R5458:Fggy UTSW 4 95926743 missense probably benign
R5868:Fggy UTSW 4 95696988 missense probably damaging 0.99
R6583:Fggy UTSW 4 95600973 missense probably benign 0.01
R6589:Fggy UTSW 4 95597638 missense probably benign 0.00
R7332:Fggy UTSW 4 95623482 missense probably damaging 0.98
R7359:Fggy UTSW 4 95769480 missense probably benign 0.40
R7453:Fggy UTSW 4 95597690 missense probably damaging 1.00
R7603:Fggy UTSW 4 95769506 missense probably damaging 1.00
R7806:Fggy UTSW 4 95600966 missense probably benign 0.02
R8072:Fggy UTSW 4 95844157 missense possibly damaging 0.75
R8199:Fggy UTSW 4 95812144 missense probably benign 0.10
R8348:Fggy UTSW 4 95844190 missense probably benign 0.11
R8430:Fggy UTSW 4 95926765 utr 3 prime probably benign
R8448:Fggy UTSW 4 95844190 missense probably benign 0.11
R8503:Fggy UTSW 4 95902058 intron probably benign
R8682:Fggy UTSW 4 95812121 missense probably damaging 1.00
X0067:Fggy UTSW 4 95696992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGAAGTACAGTGTTGCTCCC -3'
(R):5'- GGCCTGCCTGACATCAGTGTATG -3'

Sequencing Primer
(F):5'- GAGAAGATGCCATGTCTACTTGTC -3'
(R):5'- CTGCCTGACATCAGTGTATGAAAAAC -3'
Posted On2013-06-12