Mutagenetix > Incidental Mutation

Incidental Mutation 'R5503:Plcl2'

484493

Institutional Source

Beutler Lab

Gene Symbol

Plcl2

Ensembl Gene

ENSMUSG00000038910

Gene Name

phospholipase C-like 2

Synonyms

PRIP-2, Plce2

MMRRC Submission

043064-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.271) question?

Stock #

R5503 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

50509547-50688493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50509929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 108 (I108V)

Ref Sequence

ENSEMBL: ENSMUSP00000046584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043938]

AlphaFold

Q8K394

Predicted Effect

probably benign
Transcript: ENSMUST00000043938
AA Change: I108V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: I108V

Domain	Start	End	E-Value	Type
low complexity region	20	49	N/A	INTRINSIC
PH	143	254	2.88e-5	SMART
Pfam:EF-hand_like	344	426	3.7e-29	PFAM
PLCXc	427	571	2.19e-84	SMART
PLCYc	619	735	4.37e-61	SMART
C2	756	862	3.45e-19	SMART

Meta Mutation Damage Score

0.0627

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in Plcl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Plcl2	APN	17	50606920	missense	probably benign	0.01
IGL01746:Plcl2	APN	17	50607696	missense	probably benign	0.00
IGL02227:Plcl2	APN	17	50606397	missense	probably damaging	0.97
IGL02232:Plcl2	APN	17	50606641	missense	possibly damaging	0.66
IGL02878:Plcl2	APN	17	50607355	missense	probably damaging	1.00
IGL02985:Plcl2	APN	17	50687814	nonsense	probably null
acerbic	UTSW	17	50608113	missense	probably damaging	1.00
Balsamic	UTSW	17	50607661	missense	probably damaging	1.00
Bastante	UTSW	17	50606361	nonsense	probably null
italietta	UTSW	17	50608762	missense	probably damaging	1.00
Oxalic	UTSW	17	50608099	missense	probably damaging	1.00
Parece	UTSW	17	50607846	missense	probably damaging	0.99
picolinic	UTSW	17	50668160	splice site	probably null
ranch	UTSW	17	50509929	missense	probably benign	0.00
verdad	UTSW	17	50608081	missense	probably damaging	1.00
vinagrette	UTSW	17	50606856	nonsense	probably null
BB007:Plcl2	UTSW	17	50606803	missense	probably benign
BB017:Plcl2	UTSW	17	50606803	missense	probably benign
IGL03014:Plcl2	UTSW	17	50611001	missense	possibly damaging	0.65
R0110:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0190:Plcl2	UTSW	17	50607643	missense	probably benign
R0280:Plcl2	UTSW	17	50607034	missense	probably damaging	1.00
R0414:Plcl2	UTSW	17	50607955	missense	possibly damaging	0.90
R0450:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0760:Plcl2	UTSW	17	50608774	missense	possibly damaging	0.82
R1134:Plcl2	UTSW	17	50608110	missense	probably benign
R1168:Plcl2	UTSW	17	50607072	missense	possibly damaging	0.49
R1381:Plcl2	UTSW	17	50607729	missense	probably damaging	0.99
R1748:Plcl2	UTSW	17	50606798	missense	probably benign
R1856:Plcl2	UTSW	17	50607850	missense	probably benign	0.13
R1958:Plcl2	UTSW	17	50608081	missense	probably damaging	1.00
R2016:Plcl2	UTSW	17	50606694	missense	probably damaging	1.00
R2057:Plcl2	UTSW	17	50668111	splice site	probably null
R2077:Plcl2	UTSW	17	50606829	missense	probably benign
R2247:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R3083:Plcl2	UTSW	17	50687744	missense	probably benign	0.06
R4153:Plcl2	UTSW	17	50606361	nonsense	probably null
R4574:Plcl2	UTSW	17	50607846	missense	probably damaging	0.99
R4870:Plcl2	UTSW	17	50607226	missense	possibly damaging	0.46
R5030:Plcl2	UTSW	17	50607319	missense	possibly damaging	0.92
R5330:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5331:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5920:Plcl2	UTSW	17	50608675	missense	probably damaging	0.99
R6238:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R6378:Plcl2	UTSW	17	50668160	splice site	probably null
R6603:Plcl2	UTSW	17	50607117	missense	probably benign	0.03
R6633:Plcl2	UTSW	17	50640140	missense	probably benign	0.00
R7113:Plcl2	UTSW	17	50606464	missense	probably damaging	1.00
R7466:Plcl2	UTSW	17	50608468	missense	probably damaging	1.00
R7665:Plcl2	UTSW	17	50607157	missense	probably benign	0.00
R7930:Plcl2	UTSW	17	50606803	missense	probably benign
R8114:Plcl2	UTSW	17	50687787	missense	probably damaging	0.97
R8152:Plcl2	UTSW	17	50607661	missense	probably damaging	1.00
R8208:Plcl2	UTSW	17	50608315	missense	probably damaging	1.00
R8853:Plcl2	UTSW	17	50606856	nonsense	probably null
R8911:Plcl2	UTSW	17	50608113	missense	probably damaging	1.00
R8940:Plcl2	UTSW	17	50608762	missense	probably damaging	1.00
R8979:Plcl2	UTSW	17	50640117	missense	possibly damaging	0.64
R9127:Plcl2	UTSW	17	50611004	missense	probably benign	0.05
R9253:Plcl2	UTSW	17	50608099	missense	probably damaging	1.00
R9453:Plcl2	UTSW	17	50608363	missense	probably damaging	1.00
R9469:Plcl2	UTSW	17	50606925	missense	probably benign	0.05
R9630:Plcl2	UTSW	17	50640119	missense	probably benign
X0026:Plcl2	UTSW	17	50607560	missense	probably benign	0.03
Z1088:Plcl2	UTSW	17	50606992	missense	probably damaging	1.00
Z1176:Plcl2	UTSW	17	50608456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGTAATTCCGCCTGCAC -3'
(R):5'- ATGTCAGAGCACAGCACTC -3'

Sequencing Primer
(F):5'- GACGCGGCTTTGTGCAG -3'
(R):5'- TGCACACTCAGATCACCTCTC -3'

Posted On

2017-07-21